Detection kit and method for copy number of spinal muscular atrophy pathogenic gene SMN1 based on real-time fluorescence quantitative PCR (Polymerase Chain Reaction) technique

A technology of real-time fluorescence quantification and spinal muscular atrophy, which is applied in the direction of microbial determination/inspection, biochemical equipment and methods, etc., and can solve the problem that the specificity of amplification products or indicator probes cannot be guaranteed, the amount of products varies greatly, and the copy In order to achieve the results of accurate and reliable detection results, avoid non-specific amplification, and improve specificity and amplification efficiency

Inactive Publication Date: 2018-08-14
CENT SOUTH UNIV
View PDF3 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, similar to MLPA, most current real-time fluorescent quantitative PCR techniques only design primers or probes for the specific site c.840C of the SMN1 gene, and the specificity of only one specific site for the amplification product or indicator probe cannot be guaranteed For general primers, when the copy numbers of the target gene SMN1 and the pseudogene SMN2 or the internal reference gene are greatly different, or when the amount of each product in the first PCR reaction is greatly different, there may be an advantage in amplification and the amplification of the target gene SMN1 or the internal reference gene Increased efficiency produces a large difference, resulting in abnormal results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection kit and method for copy number of spinal muscular atrophy pathogenic gene SMN1 based on real-time fluorescence quantitative PCR (Polymerase Chain Reaction) technique
  • Detection kit and method for copy number of spinal muscular atrophy pathogenic gene SMN1 based on real-time fluorescence quantitative PCR (Polymerase Chain Reaction) technique
  • Detection kit and method for copy number of spinal muscular atrophy pathogenic gene SMN1 based on real-time fluorescence quantitative PCR (Polymerase Chain Reaction) technique

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0044] 1) Sample DNA concentration dilution

[0045] 152 DNA samples verified by other methods were diluted to a final concentration of 10-30ng / μl. The samples included 39 SMN1 double-copy normal individuals, 73 single-copy carriers, and 40 homozygous deletion patients.

[0046] 2) Dilution of standard plasmid DNA concentration

[0047] Standards were diluted 1:10:100:1000 for the preparation of the standard curve.

[0048] 3) PCR reaction system configuration

[0049] The PCR reaction system is 20 μl, and each reaction component is as follows:

[0050]

[0051] DNA was replaced with ddH in the negative control control reaction 2 O.

[0052] Primers and probes are as follows:

[0053] Primer: SMN1-F:ATAAAGCTATCTATATATAGCTATCTAT / LNA_G / (SEQ ID NO.1);

[0054] Primer: SMN1-R:CCTTCTTTTTGATTTTGTCT / LNA_G / (SEQ ID NO.2);

[0055] Probe: SMN-P:FAM-ACCCTGTAAGGAAAATAAAGGAAGT-MGB (SEQ ID NO.3);

[0056] Blocking probe: SMN2-B:TTCTTTTTGATTTTGTC / LNA_T / / LNA_A / AAACCC-C3 Spacer (SE...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a detection kit and a method for copy number of spinal muscular atrophy pathogenic gene SMN1 based on a real-time fluorescence quantitative PCR (Polymerase Chain Reaction) technique. The detection kit comprises specific primers SMN1-F (SEQ ID NO.1) and SMN1-R (SEQ ID NO.2) modified by NO.7 exon locked nucleic acid of a pair of target genes SMN1, an SMN1 detection probe (SEQID NO.3), an SMN2 gene closed probe SMN2-B (SEQ ID NO.4) modified by SMN-P locked nucleic acid and 3'end C3Spacer, gene primers ALB-F (SEQ ID NO.5) and ALB-R (SEQ ID NO.6) of a reference gene ALB andan ALB detection probe ALB-P (SEQ ID NO.7). The amplification specificity and amplification efficiency of the SMN1 gene are enhanced by using locked nucleic acid modification; a stable reaction system for double amplification of the target genes and the reference gene is established by using a multi-PCR principle and optimizing reaction systems and conditions, and further quantitative accuracy and reliability of the copy number of the SMN1 can be ensured; good repeatability and high operability are obtained.

Description

technical field [0001] The invention belongs to the technical field of in vitro nucleic acid detection, and specifically relates to a detection kit and method for the copy number of the spinal muscular atrophy pathogenic gene SMN1 based on real-time fluorescent quantitative PCR technology. Background technique [0002] Spinal muscular atrophy (SMA) is an autosomal recessive neuromuscular disease characterized by nuclear degeneration of the anterior horn motor neurons of the spinal cord and brainstem motor neurons, and is the second most common fatal disease Autosomal recessive genetic disease, the incidence rate is about 1 / 6000-1 / 10000, and the carrier rate in the population is about 1 / 35-1 / 50. [0003] Studies have shown that motor neuron survival genes (Survival of MotorNeuron, SMN) located on chromosome 5, including SMN1 at the telomere end and SMN2 at the centromere end, are closely related to the occurrence and development of SMA. Among them, the gene defect of SMN1 is...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6851
CPCC12Q1/6851C12Q2535/131C12Q2525/117C12Q2537/143C12Q2545/101
Inventor邬玲仟
OwnerCENT SOUTH UNIV