Primer pair, kit and use, and method for detecting whether soybeans are contained in alfalfa products
A technology of alfalfa and primer pairs, applied in biochemical equipment and methods, microbiological determination/inspection, DNA/RNA fragments, etc., can solve the problems of consuming a lot of manpower, material resources, financial resources, low nutritional value, and no detection methods , to achieve the effect of improving experimental efficiency and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Embodiment 1 A kind of primer pair that detects alfalfa and soybean
[0054] This embodiment provides a pair of primers for detecting alfalfa and soybean, the pair of primers includes primer MD5-F and primer MD5-R, wherein primer MD5-F has the sequence shown in SEQ ID NO.1, and primer MD5- R has the sequence shown in SEQ ID NO.2.
[0055] MD5-F (5'-3'): TCCGTACCAACTCAAGATATGC
[0056] MD5-R(5'-3'):TAAGCTCCAATTGCATCATAGG
Embodiment 2
[0057] Embodiment 2 A kind of test kit for detecting alfalfa and soybean
[0058] This embodiment provides a kit for detecting alfalfa and soybean, which kit includes the following components: primer MD5-F and primer MD5-R, 2×PCR Master and ddH 2 O;
[0059] 2×PCR Master contains 3mM MgCl 2 , 0.2mM dNTP, 0.1U / μl Taq and 2×PCR Buffer.
Embodiment 3
[0060] Embodiment 3 A kind of method that detects the soybean in the alfalfa grass pellet feed
[0061] The present embodiment provides a kind of method that detects the soybean in the alfalfa grass pellet feed, and this method comprises the steps:
[0062] A) collect the alfalfa grass particles, and extract the grass particle genomic DNA for subsequent use;
[0063] B) PCR amplification is carried out to the genomic DNA extracted in step A) using primer MD5-F and primer MD5-R;
[0064]The PCR amplification system is a 20 μl system, including 10 μl of 2×PCR Master, 1 μl of DNA template with a concentration of 50 ng / μl, 1 μl of primer MD5-F with a concentration of 10 nM, 1 μl of primer MD5-R with a concentration of 10 nM and ddH 2 O 7μl; where 2×PCR Master includes 3mM MgCl 2 , 0.2mM dNTP, 0.1U / μl Taq and 2×PCR Buffer;
[0065] PCR amplification program: a) 94°C pre-denaturation for 4 minutes; b) 94°C denaturation for 30 seconds; c) 58°C annealing for 30 seconds; d) 72°C ext...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


