Unlock instant, AI-driven research and patent intelligence for your innovation.

Primer pair, kit and use, and method for detecting whether soybeans are contained in alfalfa products

A technology of alfalfa and primer pairs, applied in biochemical equipment and methods, microbiological determination/inspection, DNA/RNA fragments, etc., can solve the problems of consuming a lot of manpower, material resources, financial resources, low nutritional value, and no detection methods , to achieve the effect of improving experimental efficiency and high sensitivity

Active Publication Date: 2021-05-14
LANZHOU UNIVERSITY
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to its hard texture and high lignin content, soybean straw is only used as roughage for cattle and sheep when forage is in short supply and expensive in spring. If soybean straw is crushed and added to alfalfa granules, it will Decrease the quality of grass pellets, the nutritional value of soybean stalks directly as feed is low, and the effective rumen degradation rate of dry matter is only 17.98%, thus harming the rights and interests of consumers
[0004] When alfalfa is crushed into grass powder and used to make grass pellets, it is impossible to tell whether it is mixed with soybean straw by naked eyes. If users buy a large amount of alfalfa grass pellets containing soybean straw, it will be harmful to the rights and interests of consumers. Due to the huge damage, it will consume a lot of manpower, material resources and financial resources to detect the quality of alfalfa particles by conventional chemical analysis methods, and there is no unified and effective detection method at home and abroad.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer pair, kit and use, and method for detecting whether soybeans are contained in alfalfa products
  • Primer pair, kit and use, and method for detecting whether soybeans are contained in alfalfa products
  • Primer pair, kit and use, and method for detecting whether soybeans are contained in alfalfa products

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Embodiment 1 A kind of primer pair that detects alfalfa and soybean

[0054] This embodiment provides a pair of primers for detecting alfalfa and soybean, the pair of primers includes primer MD5-F and primer MD5-R, wherein primer MD5-F has the sequence shown in SEQ ID NO.1, and primer MD5- R has the sequence shown in SEQ ID NO.2.

[0055] MD5-F (5'-3'): TCCGTACCAACTCAAGATATGC

[0056] MD5-R(5'-3'):TAAGCTCCAATTGCATCATAGG

Embodiment 2

[0057] Embodiment 2 A kind of test kit for detecting alfalfa and soybean

[0058] This embodiment provides a kit for detecting alfalfa and soybean, which kit includes the following components: primer MD5-F and primer MD5-R, 2×PCR Master and ddH 2 O;

[0059] 2×PCR Master contains 3mM MgCl 2 , 0.2mM dNTP, 0.1U / μl Taq and 2×PCR Buffer.

Embodiment 3

[0060] Embodiment 3 A kind of method that detects the soybean in the alfalfa grass pellet feed

[0061] The present embodiment provides a kind of method that detects the soybean in the alfalfa grass pellet feed, and this method comprises the steps:

[0062] A) collect the alfalfa grass particles, and extract the grass particle genomic DNA for subsequent use;

[0063] B) PCR amplification is carried out to the genomic DNA extracted in step A) using primer MD5-F and primer MD5-R;

[0064]The PCR amplification system is a 20 μl system, including 10 μl of 2×PCR Master, 1 μl of DNA template with a concentration of 50 ng / μl, 1 μl of primer MD5-F with a concentration of 10 nM, 1 μl of primer MD5-R with a concentration of 10 nM and ddH 2 O 7μl; where 2×PCR Master includes 3mM MgCl 2 , 0.2mM dNTP, 0.1U / μl Taq and 2×PCR Buffer;

[0065] PCR amplification program: a) 94°C pre-denaturation for 4 minutes; b) 94°C denaturation for 30 seconds; c) 58°C annealing for 30 seconds; d) 72°C ext...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a primer pair, a kit, its use and a method for detecting whether soybeans are contained in alfalfa products, and relates to the field of biotechnology. The primer pair comprises primer MD5‑F and primer MD5‑R, which have sequences shown in SEQ ID NO.1 and SEQ ID NO.2 respectively, and can simultaneously amplify DNA fragments of different fragment lengths from alfalfa and soybean, so A single amplification can tell whether the test sample contains alfalfa and / or soybean. Using the above primers to detect whether soybeans are contained in alfalfa products has the advantages of strong sensitivity, high accuracy, strong repeatability, fast and convenient, etc., and can detect large quantities of alfalfa products, alleviating the lack of a method in the prior art. Method for detecting soy adulteration in alfalfa feed.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a primer pair, a kit and its use and a method for detecting whether soybeans are contained in alfalfa products. Background technique [0002] Alfalfa (Medicago sativa L.) has the characteristics of high quality, high yield, high feed value (crude protein content 21%), good palatability and wide application, and is known as the "king of forage grass" in the world. After the forage grass is granulated, the density is increased by more than 5 times compared with the original, which has the advantages of reduced volume and convenient storage and transportation. Alfalfa grass pellets are favored by farmers because of their small size, convenient feeding, high nutritional value, and storage resistance. They are an important way to use alfalfa as feed. More than 50% of the cattle feed used in European and American countries is grass pellets. Feeding alfalfa pellets can significantly improv...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895
Inventor 闫龙凤申书恒刘志鹏刘斌罗栋包琴燕王彦荣
Owner LANZHOU UNIVERSITY