Methods for gender determination of avian embryos in unhatched eggs and means thereof

A poultry and gender technology, applied in biochemical equipment and methods, other methods of inserting foreign genetic materials, microbe determination/inspection, etc., can solve problems such as effective and non-invasive methods without sex identification

Inactive Publication Date: 2018-08-31
EGGXYT LTD
View PDF13 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0031] Therefore, there is currently no effective and non-invasive method of sexing chickens at the egg stage prior to hatching available

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Methods for gender determination of avian embryos in unhatched eggs and means thereof
  • Methods for gender determination of avian embryos in unhatched eggs and means thereof
  • Methods for gender determination of avian embryos in unhatched eggs and means thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0251] Selection of reporter genes for visual sex recognition in poultry

[0252] To demonstrate the feasibility of visually identifying the sex of poultry in ovo, the application of bioluminescence was evaluated in comparison to a fluorescent reporter. Therefore, a transgenic mouse expressing a reporter gene, such as firefly luciferase (having a nucleic acid sequence as shown in SEQ ID NO: 20; encoding an amino acid sequence as shown in SEQ ID NO: 21) and Green fluorescent protein (eGFP).

[0253] To observe luciferase activity, luciferin was injected subcutaneously into luciferase-expressing transgenic mice in Figure 1, then the tail and ears were excised and introduced through a 5 mm hole in the eggshell of unfertilized eggs. As shown in the figure, in tail and ear samples ( Figure 1A , 1B) A luciferase detectable signal was clearly observed through the eggshell. Therefore, the present inventors next examined the feasibility of inducing a luciferase response in ovo. Ther...

Embodiment 2

[0259] Design of guide RNA vector

[0260] To integrate the luciferase reporter gene in sex chromosome W or Z, a CRISPR / Cas9-mediated HDR approach was chosen. The relevant gRNA loci were then searched from the two sex chromosomes.

[0261] The region 1022859-1024215 of chromosome W of a female chicken containing the nucleic acid sequence shown in SEQ ID NO.3 was analyzed for guide RNA design. Through the non-restricted cloning scheme, select, synthesize two guide RNAs, and clone it into the Cas9 SmartNuclease carrier containing wild-type Cas9 nuclease (Horizon), respectively, the two guide RNAs are: gRNA1:GCACTAGGAACCAGCAGCAG, as SEQ ID Shown in NO.1, and gRNA2: GTAGCCCCAAGAGGGCTAGG, shown in SEQ ID NO.2.

[0262] The predicted parameters for these two gRNAs are shown in Table 1:

[0263] Table 1

[0264] gRNA parameters

gRNA1

gRNA2

sgRNA Designer

0.506

0.63

sscore

0.8677

0.5323

sgRNA scorer

94.8

99.9

[0265] F...

Embodiment 3

[0269] Design of Luciferase Targeting Vector

[0270] Flanking sequences homologous to the appropriate flanking sequences described above for the female W chromosome or female Z chromosome loci are introduced upstream of the CMV promoter and downstream of neomycin resistance or polyA sites in vectors expressing luciferase (Custom synthetic DNA, Integrated DNA Technologies, Inc., USA).

[0271] For the female W chromosome, the reporter gene, especially luciferase, can be cloned using Guide 1 (gRNA1) shown in SEQ ID NO.1 or Guide 2 (gRNA2) shown in SEQ ID NO.2. For cloning using gRNA1, a "left arm" comprising the nucleic acid sequence shown in SEQ ID NO.4 and a "right arm" comprising the nucleic acid sequence shown in SEQ ID NO.5 are provided. For cloning using gRNA2, a "left arm" comprising the nucleic acid sequence shown in SEQ ID NO.6 and a "right arm" comprising the nucleic acid sequence shown in SEQ ID NO.7 are provided.

[0272] Further, the "left arm" of the region upst...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to methods of gender determination and identification in avian subjects. More specifically, the invention provides non-invasive methods using transgenic avian animals that comprise at least one reporter gene integrated into at least one gender chromosome Z or W. The transgenic avian animals of the invention are used for gender determination and selection of embryos inunhatched avian eggs.

Description

technical field [0001] The present invention relates to methods of sex determination and identification in avian subjects. More specifically, the present invention provides non-invasive methods and transgenic avian animals for sex determination and selection of embryos in unhatched avian eggs. Background technique [0002] References considered to be relevant to the subject matter of the present disclosure are listed below: [0003] · WO 2010 / 103111 [0004] ·WO 2014 / 0296707 [0005] ·US 6244214 [0006] ·06124456A2 [0007] ·US2014069336A [0008] ·WO16005539 [0009] ·WO 96 / 39505 [0010] ·WO 97 / 49806 [0011] ·Quansah, E., Long, J.A., Donovan, D.M., Becker, S.C., Telugu, B., FosterFrey, J.A., Urwin, N. 2014. Sperm-mediated transgenesis in chicken using a PiggyBac transposon system. Poultry Science Association Meeting Abstract. BARCPoster Day. [0012] · Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J.A., & Charpentier, E. (2012). A programmable dual-...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6879A01K67/027C12N5/10C12N15/85C12N15/90
CPCC12Q1/68C12N9/0069C12N15/102C12N15/907A01K2217/07A01K2227/30A01K2267/0393C12Q1/6879C12Q1/66A01K67/0275C12N15/113C12N2310/20
InventorD·奥芬
OwnerEGGXYT LTD