Method used for modification of Jing Nongke 728 strain through molecular mark assisted rapid reduction of corn leaf intersection angles

A molecular marker-assisted, corn leaf angle technology, applied in the field of molecular genetics, can solve the problems of long line selection time and low efficiency, and achieve the effects of improving accuracy, reducing leaf angle, and saving line selection time.

Active Publication Date: 2018-09-04
BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It can be seen that using the conventional backcross transfer method, for the traits controlled by a recessive single gene, it is necessary to use backcross and self-cross alternate methods to accurately select the target traits, which takes a long time and low efficiency

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method used for modification of Jing Nongke 728 strain through molecular mark assisted rapid reduction of corn leaf intersection angles

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Screening of maize ligule lg1 gene SSR molecular markers

[0031] 1. Using the maize genome database MaizeGDB (http: / / www.maizegdb.org / ), select a total of 9 SSR molecular markers in the upstream and downstream intervals with a close genetic distance to the lg1 gene located at the end of the short arm of the second chromosome of maize.

[0032] Table 1 The positions and primer sequences of the upstream and downstream markers of the ligule gene lg1

[0033] Primer name

sequence(5'to3')

chromosome location

umc2245-L

GCCCTGTTATTGGAACAGTTTACG

30.9

umc2245-R

CGTCGTCTTCGACATGTACTTCAC

isu308337-L

TTCTTGCTTGTCTCTAGCAGCTT

35.6

isu308337-R

TGTGGCGATGTCCATGATT

isu488638-L

AGGCAACTCCTGTGTCTGTGT

45.2

isu488638-R

CATGATCGCCCACTCCTT

umc1165-L

TATCTTCAGACCCAAACATCGTCC

47.4

umc1165-R

GTCGATTGATTTCCCGATGTTAAA

phi098-L

GAGATCACCGGCTAG...

Embodiment 2

[0042] Example 2 Breeding of maize liguleless inbred lines

[0043] 1. Acquisition of hybrid offspring F1

[0044] In the summer of the first year, the maize inbred line rla1 (non-recurrent parent, without ligule) was used as the donor, Jing 2416 (available from the Corn Research Center of Beijing Academy of Agriculture and Forestry) (recurrent parent, with ligule, hybrid Jingnong The male parent of family 728) was used as a recipient hybrid to form F 1 Generation, Harvest F 1 generation of seeds.

[0045] The first generation in Hainan in the winter of the same year, planting F 1 generation seed, get F 1 Substitute maize plants.

[0046] 2. Obtain the BC1 generation by backcrossing once

[0047] (1) Backcross

[0048] The F1 generation plants were used as the female parent, and continued to backcross with the recurrent parent Jing 2416, and the seeds of the BC1 generation were harvested. In the winter of the same year, the second generation in Hainan planted the seeds...

Embodiment 3

[0074] Example 3 Improving Jingnongke 728 plant type to obtain a corn hybrid with reduced leaf angle

[0075] Jingnongke 728 is a maize variety bred from Beijing MC01×Jing 2416 by the Maize Research Center of Beijing Academy of Agriculture and Forestry Sciences. In this example, the maize inbred line Jing MC01 was used as the female parent, and the ligule-less inbred line Jing 2416Y obtained in Example 2 was used as the male parent to form a combination, and Biyuan Jingnongke 728 (grouped by Jing MC01 and Jing 2416) was obtained. A compact maize hybrid with a reduced leaf angle of about 10 degrees and no significant difference in other traits from the original variety Jingnongke 728.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method used for modification of Jing Nongke 728 strain through molecular mark assisted rapid reduction of corn leaf intersection angles. According to the method, two SSR molecular markers closely linked with corn liguliss gene lg1 are adopted, corn Jing 2416 is taken as a recurrent parent, a lg1 gene-containing liguliss corn selfing line is taken as a nonrecurrent parent,and hybridization, three times of backcross, molecular mark assisted prospect and background selection, and selfing are adopted so as to obtain a liguliss corn selfing line with a genetic background basically the same with that of the recurrent parent; the liguliss corn selfing line and Jing MC01 are combined, so that a compact type corn hybrid variety with the genetic background basically the same with that of the original hybrid variety and obviously reduced leaf intersection angles is obtained rapidly. The method is capable of saving almost one half breeding time, is capable of reducing leaf intersection angles of conventional hybrid varieties rapidly, promoting breeding of the compact type corn hybrid variety with obviously reduced leaf intersection angles, and is promising in application prospect.

Description

technical field [0001] The invention relates to the field of molecular genetics, in particular to a method for improving the plant type of Jingnongke 728 by using the SSR molecular marker linked to the maize ligule gene lg1 to assist in rapidly reducing the angle between maize leaves. Background technique [0002] In recent years, with the breeding goals of maize tolerance to dense planting and high light efficiency, compact plant type and leaf upshoot have become important phenotypic traits that maize breeders pay attention to. Corn leaf angle is an important plant type index, which directly affects the distribution of light in the canopy and the light energy utilization of the population, thereby affecting the process of plant growth and physiological characteristics, and is an important agronomic trait that affects yield. Upright leaves can significantly improve photosynthetic efficiency and plant density, thereby increasing yield. The leaf angle is small and the plant ty...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A01H1/02A01H1/04C12Q1/6895
CPCA01H1/02A01H1/04C12Q1/6895C12Q2600/13C12Q2600/156
Inventor赵久然宋伟苏爱国邢锦丰张如养王元东王继东王帅帅
OwnerBEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES