Recombinant Clostridium beijerinckii for efficient sucrose fermentation and method for improving sucrose fermentation performance of Clostridium beijerinckii

A technology of Clostridium beijerinckii and sucrose, which is applied in the field of genetic engineering, can solve the problem that the performance of Clostridium beijerinckii for fermentation and utilization of carbon sources cannot be accurately controlled, etc., to improve the transport efficiency of sucrose, increase the yield of butanol, and improve the high-efficiency utilization Effect

Active Publication Date: 2018-09-07
GUANGXI ACAD OF SCI
View PDF6 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the selection method has a certain degree of randomness, and the performance of the selected Clo

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant Clostridium beijerinckii for efficient sucrose fermentation and method for improving sucrose fermentation performance of Clostridium beijerinckii
  • Recombinant Clostridium beijerinckii for efficient sucrose fermentation and method for improving sucrose fermentation performance of Clostridium beijerinckii
  • Recombinant Clostridium beijerinckii for efficient sucrose fermentation and method for improving sucrose fermentation performance of Clostridium beijerinckii

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1: Construction of the recombinant expression plasmid pSOS95-SUT1 containing the sucrose transporter gene SUT1

[0048] Amplify the linearized pSOS95 vector portion by PCR:

[0049] Upstream primer: 5'-TAAAAATAAGAGTTACCTTAAATGGTAACT-3', (SEQ ID NO.3);

[0050] Downstream primer: 5'-TTTAATCCCTCCTTTTTAAATTCTGGATCCT-3', (SEQ ID NO.4).

[0051] The PCR reaction program was: pre-denaturation at 98°C for 3 min, 30 cycles at 98°C for 10 s, 60°C for 15 s, 72°C for 5 min, and finally extension at 72°C for 10 min.

[0052] Using PCR technology to amplify the target gene SUT1:

[0053] Upstream primers:

[0054] 5'- CCAGAATTTAAAAGGAGGGATTAAA ATGGAGAATGGTACAAAAAGAGAAGG-3', (SEQ ID NO. 5);

[0055] Downstream primers:

[0056] 5'- CCATTTAAGGTAACTCTTATTTTTA TTATTTAATGGAAAGCCCCATGGCGAC-3', (SEQ ID NO. 6);

[0057] Underlined parts in italics are homologous sequences to the vector.

[0058] The PCR reaction program was: 98°C pre-denaturation for 3 minutes, 98°C for 1...

Embodiment 2

[0060] Example 2: Construction of recombinant Clostridium beijerinckii 8052-SUT1 expressing SUT1 gene heterologously

[0061] The expression plasmid pSOS95-SUT1 containing the sucrose transporter gene and the empty vector plasmid pSOS95K were respectively transferred into E.coli JM109 (pAN1) for methylation, and the methylated plasmids pSOS95-SUT1 and pSOS95K were respectively introduced by electroporation In C. beijerinckii 8052, positive transformants were screened on a TYA plate containing 50ug / mL erythromycin.

[0062] The culture temperature is 30°C, and the culture time is 2-3 days. Select transformants from the selection plate, and obtain positive recombinant strains after colony PCR verification (upstream primer: AGGCATTAGTGCATTTAAGC (SEQ ID NO.7), downstream primer: CCAGGCTTTACACTTTATGC (SEQ ID NO.8); PCR reaction program: 98 ° C pre-denaturation 10min, 98°C for 10s, 53°C for 15s, 72°C for 2min, 30 cycles, and finally 72°C for 10min). figure 2 .

[0063] The recom...

Embodiment 3

[0064] Example 3: Construction of recombinant expression plasmid pSOS95-SUT1-SUC2 containing sucrose transporter gene SUT1 and sucrase gene SUC2

[0065] PCR amplification of the linearized pSOS95-SUT vector portion:

[0066] Upstream primer: 5'-TAAAAATAAGAGTTACCTTAAATGG-3', (SEQ ID NO.9);

[0067] Downstream primer: 5'- CCCTCCT TTATTTAATGGAAAGCCCCATGGCGACTGC-3', (SEQ ID NO. 10).

[0068] (The part in italics underlined in the primer is the SD sequence)

[0069] The PCR reaction program was: pre-denaturation at 98°C for 3min, 30 cycles at 98°C for 10s, 57°C for 15s, 72°C for 6min, and finally extension at 72°C for 10min.

[0070] PCR amplification of the SUC2 gene:

[0071] Upstream primer: 5'-

[0072] GGCTTTCCATTAAATAA AGGAGGGATTAAAATGACAAACGAAACTAGCGATAG-3', (SEQ ID NO. 11);

[0073] Downstream primers:

[0074] 5'- CCATTTAAGGTAACTCTTATTTTTA CTATTTTACTTCCCTTACTTGG-3', (SEQ ID NO. 12).

[0075] (The underlined italic part in the primer is the homologous sequence...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

In the invention, the heterologous expression of sucrose transporter SUT1 and sucrase SUC2 in Clostridium beijerinckii is successfully realized by a genetic engineering method, and then sucrose is directly fermented by using a fermentation engineering method with sucrose as a sole carbon source to produce biobutanol. Compared with the fermentation of sucrose by the wild Clostridium beijerinckii strain, the method for fermenting sucrose by the recombinant Clostridium beijerinckii constructed by the invention has the advantages that the sucrose fermentation performance of Clostridium beijerinckii is improved and the butanol yield is significantly increased.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a recombinant Clostridium beijerinckii which uses genetic engineering to construct a high-efficiency fermentation of sucrose to produce butanol. Background technique [0002] Butanol is considered to be one of the most promising new liquid fuels. With the depletion of petroleum resources and the continuous rise of crude oil prices, countries around the world are increasingly concerned about energy security and resource security, so the production of butanol by microbial fermentation is favored by people. [0003] The current production of bio-butanol in my country mainly uses corn as raw material, and Clostridium acetobutylicum (Clostridium acetobutylicum) is used to ferment and produce butanol, such as the strain Clostridium acetobutylicum HY1710 of North China Pharmaceutical Huaying Co., Ltd., and Clostridium acetobutylicum EA2018 bred by Shanghai Instit...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N1/21C12P7/16C12R1/145
CPCC07K14/415C12N9/1051C12P7/16Y02E50/10
Inventor 林丽华汤宏赤张志凯郭媛闭德武庞浩
Owner GUANGXI ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap