Short-chain dehydrogenase and mutant thereof as well as preparation of gene and application of short-chain dehydrogenase

A technology of short-chain dehydrogenase and mutants, which can be used in applications, genetic engineering, plant gene improvement, etc., and can solve problems such as low stereoselectivity and single stereoselectivity

Active Publication Date: 2018-09-18
SHENYANG PHARMA UNIVERSITY
View PDF5 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to solve the problem of low stereoselectivity and single stereoselectivity of the existing Lactobacillus fermentum short-chain dehydrogenase (LfSDR1), and obtain the enzyme mutant, the nucleic acid encoding the mutant, and the nucleic acid containing the nucleic acid through site-directed mutagenesis. Recombinant expression vectors and recombinant expression transformants, recombinant mutant enzymes catalyze the asymmetric reduction of 1-phenylethanones, and the application in the preparation of optically pure chiral alcohols of corresponding opposite configurations (R and S configurations)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Short-chain dehydrogenase and mutant thereof as well as preparation of gene and application of short-chain dehydrogenase
  • Short-chain dehydrogenase and mutant thereof as well as preparation of gene and application of short-chain dehydrogenase
  • Short-chain dehydrogenase and mutant thereof as well as preparation of gene and application of short-chain dehydrogenase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Example 1 Site-directed mutagenesis construction of a mutant gene with improved stereoselectivity based on the wild type

[0057] Using the plasmid pET22b-LfSDR1 containing the short-chain dehydrogenase LfSDR1 gene as a template, the mutant gene was obtained by overlapping extension PCR.

[0058] First, the upstream and downstream primers of the LfSDR1 gene are as follows:

[0059] LfSDR1-NdeI-F: GGAATTCCATATGGGACAGTTTG

[0060] LfSDR1-XhoI-R: CCGCTCGAGTTGTGCCGTGTAGC

[0061] Then design mutation site primers as follows:

[0062] Mutant LfSDR1-V186F

[0063] LfSDR1-V186F-F: TACCCTGGGTTTATTGCCACG

[0064] LfSDR1-V186F-R: CGTGGCAATAAACCCAGGGTA

[0065] Mutant LfSDR1-V186W

[0066] LfSDR1-V186W-F: TACCCTGGGTGGATTGCCACG

[0067] LfSDR1-V186W-R: CGTGGCAATCCACCCAGGGTA

[0068] Take the construction of mutant LfSDR1-V186F as an example:

[0069] The first step PCR reaction system is as follows:

[0070] PCR-a

[0071]

[0072] PCR-b

[0073]

[0074] Amplific...

Embodiment 2

[0081] Example 2 Site-directed mutagenesis construction of a mutant gene that is stereoselectively reversed on the basis of the wild type

[0082] Using the plasmid pET22b-LfSDR1 containing the short-chain dehydrogenase LfSDR1 gene as a template, the mutant gene was obtained by overlapping extension PCR.

[0083] The upstream and downstream primers of the LfSDR1 gene are the same as in Example 1.

[0084] The primers for the mutation sites were designed as follows:

[0085] LfSDR1-V186A-F: TACCCTGGGGCAATTGCCACG

[0086] LfSDR1-V186A-R: CGTGGCAATTGCCCCAGGGTA

[0087] LfSDR1-E141L-F: AGTTCGATCCTGGGGATGATC

[0088] LfSDR1-E141L-R: GATCATCCCCAGGATCGAACT

[0089] LfSDR1-G92F-F: GCCGGAATTTTTACTCCGCTG

[0090] LfSDR1-G92F-R: CAGCGGAGTAAAAATTCCGGC

[0091] LfSDR1-G92E-F: GCCGGAATTGAAACTCCGCTG

[0092] LfSDR1-G92E-R: CAGCGGAGTTTCAATTCCGGC

[0093] Take the construction of the LfSDR1-V186A-E141L-G92F mutant as an example:

[0094] The first step of PCR is as follows:

[0095] ...

Embodiment 3

[0111] Embodiment 3 construction mutant gene recombination plasmid

[0112]The mutant gene obtained by overlap extension PCR and the vector plasmid were subjected to double enzyme digestion, and the reaction system was as follows:

[0113]

[0114] After reacting at 37°C for 4-8 hours, use the ordinary DNA product gel recovery kit to recover the cleaved nucleic acid fragments; use T4 DNA ligase to ligate the double-digested mutant gene fragments with cohesive ends and the carrier plasmid fragments (16 ℃ reaction for 2-6h) to obtain recombinant plasmids pET22b-LfSDR1-V186F, pET22b-LfSDR1-V186W, pET22b-LfSDR1-V186A-E141L-G92F and pET22b-LfSDR1-V186A-E141L-G92E.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology, and relates to wild type short-chain dehydrogenase LfSDR1 and a gene of mutant enzyme of the short-chain dehydrogenase, construction of a recombinant expression vector containing the gene, preparation of recombinant expression transformant, recombinase and a preparation method of the recombinase. Through mutation of the wild type short-chaindehydrogenase LfSDR1, the mutant enzyme having two stereoselectivities (R or S stereoselectivities) is obtained, and catalytic asymmetrical reduction on prochiral ketone is carried out by utilizing the mutant enzyme, such as asymmetrical reduction of catalytic 1-phenyl ethanone compounds. Compared with the wild type short-chain dehydrogenase, the mutant disclosed by the invention has the advantages that the stereoselectivities is improved or reversed, a substrate is catalyzed so as to obtain chiral alcohol having two types (R or S type), such as optical pure (R)- or (S)-2-chloro-1-phenylethanol; moreover, the mutant has a good application value in the field of preparation of chiral alcohol.

Description

technical field [0001] The present invention relates to the technical field of bioengineering, in particular to a short-chain dehydrogenase LfSDH1 mutant and its coding gene, a recombinant expression vector containing the short-chain dehydrogenase mutant gene and the construction of a transformant, a method for preparing a recombinant enzyme, and Using different mutants as catalysts to catalyze the asymmetric reduction of acetophenone compounds to obtain corresponding optically pure chiral phenylethanol products with different configurations (S and R configurations). Background technique [0002] Optically pure 1-phenylethanol compounds, especially α-halogen substituted 1-phenylethanol compounds are important chiral intermediates in the synthesis of pharmaceuticals and other fine chemicals. At present, a variety of methods for obtaining optically pure and chirally pure materials have been developed, including kinetic resolution and asymmetric synthesis. The theoretical yiel...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/04C12N15/53C12P7/22
CPCC12N9/0006C12P7/22C12Y101/01184
Inventor游松秦斌秦凤玉郭继阳刘亚林张飞霆张文鹤祝天慧
OwnerSHENYANG PHARMA UNIVERSITY