Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of CHAF1A (chromatin assembly factor 1 subunit A) inhibitor in gastric cancer therapeutic medicine preparation

A technology of therapeutic drugs and inhibitors, which is applied in the field of biomedical research, can solve problems such as the unreported role of CHAF1A, and achieve the effects of inhibiting growth rate, reducing growth number, and reducing volume

Inactive Publication Date: 2018-10-26
AFFILIATED HOSPITAL OF JIANGSU UNIV +1
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The role of CHAF1A(p150) in gastric cancer remains unreported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of CHAF1A (chromatin assembly factor 1 subunit A) inhibitor in gastric cancer therapeutic medicine preparation
  • Application of CHAF1A (chromatin assembly factor 1 subunit A) inhibitor in gastric cancer therapeutic medicine preparation
  • Application of CHAF1A (chromatin assembly factor 1 subunit A) inhibitor in gastric cancer therapeutic medicine preparation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0100] Example 1 Functional experiment of CHAF1A in gastric cancer cells

[0101] 1. Method

[0102] 1. Cell lines and cell culture: Both MGC-803 and SGC-7901 were purchased from Shanghai Institute of Biochemistry, Chinese Academy of Sciences and cultured at 37°C, 5% CO 2 In the incubator, use RPMI 1640 or DMEM (GIBCO-BRL) medium.

[0103] 2. Preparation of CHAF1A RNA interference lentiviral vector

[0104] 2.1 siRNA design: Obtain the CHAF1A gene (NM_005483) sequence from Pubmed Nucleotide, use the public website to design multiple RNA interference target sequences according to the RNA interference sequence design principles, further evaluate and measure, and select the best kinetic parameter target for subsequent experiments Process, the determined target sequence of siRNA is: CCGACTCAATTCCTGTGTAAA (SEQ ID NO.1);

[0105] 2.2 Double-stranded DNA oligo preparation: synthesized by Shanghai Jikai Gene Chemical Technology Co., Ltd., the positive and negative strands are: Ccgg...

Embodiment 2

[0346] Example 2 Study on the Mechanism of CHAF1A Affecting the Malignant Phenotype of Gastric Cancer Cells

[0347] 1. Method

[0348] 1. Total RNA quality inspection of chip samples

[0349] 1.1 Basic information

[0350] Number of samples: 6; Sample type: cells

[0351] 1.2 Experiment Information

[0352] Extraction reagent: Trizol method;

[0353] Quality inspection standard: Thermo NanoDrop 2000: 1.7=7.0and 28S / 18S>0.7

[0354] 2. 3′IVT reaction: total RNA input range: 50-500ng

[0355] Table 6. RNA Amplification Procedure

[0356] 2.1 Poly-A RNA control preparation: Mix the diluted poly-A RNA with the total RNA, and the poly-A RNA is used as the internal control of the entire operation process.

[0357] 2.2 One-strand cDNA synthesis: prepare a one-strand synthesis reaction solution and add poly-A RNA / total RNA mix. Use the "First-Strand cDNA Synthesis" program to incubate to synthesize cDNA.

[0358] 2.3 Two-strand cDNA synthesis: Prepare a second-strand synth...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biomedical research, and particularly relates to application of a CHAF1A (chromatin assembly factor 1 subunit A) inhibitor in gastric cancer therapeutic medicinepreparation. Through extensive and deep researches, the CHAF1A found out for the first time can be a therapeutic target for gastric cancer therapy. By the aid of the CHAF1A inhibitor, growing number of gastric cancer cells can be decreased, increasing rate of the gastric cancer cells can be decreased, S-phase cell percentage of the gastric cancer cells can be increased, S-phase blockage of the gastric cancer cells can be increased, apoptosis rate of the gastric cancer cells can be increased, growing speed of the gastric cancer cells in becoming a tumor can be restrained, size of the tumor formed by the gastric cancer cells can be decreased, weight of the tumor formed by the gastric cancer cells can be decreased, and a new direction is developed for gastric cancer therapy.

Description

technical field [0001] The invention belongs to the field of biomedical research, and in particular relates to the use of a CHAF1A inhibitor in the preparation of drugs for treating gastric cancer. Background technique [0002] According to the report of the National Cancer Center, in 2015, my country estimated that there were 679,100 new cases of gastric cancer and 498,000 deaths that year, ranking second among malignant tumors. Gastric cancer is highly heterogeneous, so it is difficult to implement individualized prevention and treatment, which is an important reason for the difficulty of gastric cancer treatment, varying treatment responses and lack of targeted drugs. Therefore, further elucidating the molecular basis of gastric cancer to find new therapeutic targets is the key to improving the effectiveness of gastric cancer prevention and treatment. [0003] The role of CHAF1A(p150) in gastric cancer has not been reported yet. Contents of the invention [0004] In o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K45/00A61K45/06A61K49/00A61P35/00
CPCA61K45/00A61K45/06A61K49/0004A61P35/00
Inventor 王德强束永前李小琴陈德玉顾汉刚朱雯
Owner AFFILIATED HOSPITAL OF JIANGSU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com