Application of CHAF1A (chromatin assembly factor 1 subunit A) inhibitor in gastric cancer therapeutic medicine preparation
A technology of therapeutic drugs and inhibitors, which is applied in the field of biomedical research, can solve problems such as the unreported role of CHAF1A, and achieve the effects of inhibiting growth rate, reducing growth number, and reducing volume
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0100] Example 1 Functional experiment of CHAF1A in gastric cancer cells
[0101] 1. Method
[0102] 1. Cell lines and cell culture: Both MGC-803 and SGC-7901 were purchased from Shanghai Institute of Biochemistry, Chinese Academy of Sciences and cultured at 37°C, 5% CO 2 In the incubator, use RPMI 1640 or DMEM (GIBCO-BRL) medium.
[0103] 2. Preparation of CHAF1A RNA interference lentiviral vector
[0104] 2.1 siRNA design: Obtain the CHAF1A gene (NM_005483) sequence from Pubmed Nucleotide, use the public website to design multiple RNA interference target sequences according to the RNA interference sequence design principles, further evaluate and measure, and select the best kinetic parameter target for subsequent experiments Process, the determined target sequence of siRNA is: CCGACTCAATTCCTGTGTAAA (SEQ ID NO.1);
[0105] 2.2 Double-stranded DNA oligo preparation: synthesized by Shanghai Jikai Gene Chemical Technology Co., Ltd., the positive and negative strands are: Ccgg...
Embodiment 2
[0346] Example 2 Study on the Mechanism of CHAF1A Affecting the Malignant Phenotype of Gastric Cancer Cells
[0347] 1. Method
[0348] 1. Total RNA quality inspection of chip samples
[0349] 1.1 Basic information
[0350] Number of samples: 6; Sample type: cells
[0351] 1.2 Experiment Information
[0352] Extraction reagent: Trizol method;
[0353] Quality inspection standard: Thermo NanoDrop 2000: 1.7=7.0and 28S / 18S>0.7
[0354] 2. 3′IVT reaction: total RNA input range: 50-500ng
[0355] Table 6. RNA Amplification Procedure
[0356] 2.1 Poly-A RNA control preparation: Mix the diluted poly-A RNA with the total RNA, and the poly-A RNA is used as the internal control of the entire operation process.
[0357] 2.2 One-strand cDNA synthesis: prepare a one-strand synthesis reaction solution and add poly-A RNA / total RNA mix. Use the "First-Strand cDNA Synthesis" program to incubate to synthesize cDNA.
[0358] 2.3 Two-strand cDNA synthesis: Prepare a second-strand synth...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com