NtHAK8 gene and application thereof
A use, technology of transgenic plants, applied in the field of genetics
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0072] The PCR amplification of embodiment 1NtHAK8 gene and the construction of pEASY-T1+NtHAK8 recombinant vector
[0073] 1. Primer design and synthesis: upstream and downstream primers are involved, and restriction sites are added to the primers, and protective bases are also added to the upstream primers. The specific sequence is as follows:
[0074] Primer Name Base Sequence (5'to 3')
[0075] NtHAK8F CG GGATCC CGATGGATATTGAGAGTTGGGGTCGT SEQ ID NO: 3;
[0076] NtHAK8R C GAGCTC GTACATGGTAAATCATTCCAACCTCCA SEQ ID NO: 4;
[0077] Among them, the underline in NtHAK8F is the BamHI restriction site, and the underline in NtHAK8R is the SacⅠ restriction site. The primers were synthesized by Chengdu Qingke Zixi Biotechnology Co., Ltd.
[0078] 2. Extraction of total RNA from tobacco: The extraction of total RNA from tobacco plants was performed with reference to the TIANGEN RNA Pure Plant Kit. In order to prevent RNase contamination, the mortar was calcined with alcohol at...
Embodiment 2
[0139] Example 2 Construction of pC2301M1DPB+NtHAK8 recombinant vector
[0140] In this embodiment, the target gene NtHAK8 will be constructed into the pC2301M1DPB vector (for the vector map, see figure 2 shown).
[0141] Digest the target fragment on the T vector:
[0142] Target gene digestion system:
[0143]
[0144] Respectively digest at 37°C for 3 hours to obtain the digested target gene fragment and vector fragment.
[0145] Target fragment and vector recovery: the specific steps are the same as above.
[0146] Connection of target fragment and vector:
[0147]
[0148] 37°C, 2h connection.
[0149] The ligation product was transformed into Escherichia coli: the specific steps were the same as above.
[0150] Bacterial liquid PCR identification: the specific steps are the same as above, and the identification primers are the primers used in cloning.
[0151] Plasmid extraction steps and sequencing: the specific steps are the same as above. The one with c...
Embodiment 3
[0152] Example 3 Preparation of recombinant Agrobacterium tumefaciens EHA105-pC2301M1DPB+NtHAK8 cells
[0153] Expression vector transformed into Agrobacterium
[0154] 1) Add 10 μL of plasmid DNA (pC2301M1DPB+NtHAK8 recombinant vector plasmid obtained in Example 2) to Agrobacterium EH105 competent cells and mix gently;
[0155] 2) Ice bath for 30 minutes, then freeze the competent cells in liquid nitrogen for 8 minutes, then quickly place them in a 37°C water bath for 5 minutes, and then ice-bath for 2 minutes;
[0156] 3) Add 850 μL of antibiotic-free YEB liquid medium on the ultra-clean workbench, mix it upside down, and incubate on a shaker at 225 rpm at 28°C for 4 hours;
[0157] 4) After culturing for 4 hours, centrifuge at 4,000 rpm for 5 minutes, remove 800 μL of supernatant, and blow and mix with a sterile pipette tip;
[0158] 5) Apply the remaining suspension on the YEB solid medium plate containing Kana (see Table 1 for the formula) and rif (see Table 1 for the f...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More