nthak5 gene and its use
A gene and application technology, applied in the field of promoting plant potassium absorption, NtHAK5 gene, can solve the problems of potassium fertilizer loss in the ecological environment, low potassium content in tobacco leaves, and obvious gaps, etc., achieve the effect of reasonable control of yield and quality, and increase potassium absorption content
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0104] Example 1: PCR amplification of NtHAK5 gene and construction of pEASY-T1+NtHAK5 recombinant vector
[0105] 1. Primer design and synthesis: respectively design gene-specific primers for gene cloning in common tobacco. The primers were synthesized by Chengdu Qingke Zixi Biotechnology Co., Ltd. The primer sequence (5'to 3') is as follows
[0106] NtHAK5F CC CCCGGG GGATGGCGAGCGCAGATAGTGAT SEQ ID NO: 3;
[0107] NtHAK5R CC CCCGGG GGTAATTCATAAGTCATGCCGACCCTTA SEQ ID NO:4.
[0108]Note: The underline in the above sequence indicates the restriction site of Xma I.
[0109] 2. Extraction of total RNA from tobacco: The extraction of total RNA from tobacco plants was carried out with reference to the TIANGEN RNA Pure Plant Kit kit. In order to prevent RNase contamination, the mortar was calcined with alcohol at high temperature and cooled naturally to room temperature for later use; the pipette tips and centrifuge tubes used in the experiment were all imported RNase-Free m...
Embodiment 2
[0165] Example 2 Construction of pC2301M1DPB+NtHAK5 recombinant vector
[0166] The target gene NtHAK5 was constructed into the pC2301M1DPB vector (see figure 2 ).
[0167] 1. Digest the target fragment on the pEASY-T1+NtHAK5 recombinant vector:
[0168] The enzyme digestion system for the target gene is:
[0169]
[0170] The vector digestion system is:
[0171]
[0172]
[0173] Enzyme digestion at 37°C for 3h.
[0174] 2. Vector inactivation: place the digested vector in PCR at 85°C for 10 min.
[0175] 3. Carrier dephosphorylation: add the inactivated carrier
[0176] wxya 2 O 6μL
[0177] 10×Alkaline Phosphatase Buffer 12μL
[0178] CIAP 2μL
[0179] PCR program: 37°C, 45min.
[0180] 4. Target fragment and carrier recovery: the specific steps are the same as above.
[0181] 5. Connection of target fragment and vector:
[0182]
[0183] 37°C, 2h connection.
[0184] 6. Transformation of the ligation product into Escherichia coli: the specific ste...
Embodiment 3
[0187] Example 3 Preparation of recombinant Agrobacterium tumefaciens EHA105-pC2301M1DPB+NtHAK5 cells
[0188] 1. Transformation of Agrobacterium with expression vector
[0189] 1) Add 10 μL of plasmid DNA (the plasmid DNA of pC2301M1DPB+NtHAK5 recombinant vector obtained in Example 2) to Agrobacterium EH105 competent cells and mix gently;
[0190] 2) Ice bath for 30 minutes, then freeze the competent cells in liquid nitrogen for 8 minutes, then quickly place them in a 37°C water bath for 5 minutes, and then ice-bath for 2 minutes;
[0191] 3) Add 850 μL of antibiotic-free YEB liquid medium (recipe in Table 2) on the ultra-clean workbench, mix it upside down, and incubate on a shaker at 225 rpm at 28°C for 4 hours;
[0192] 4) After culturing for 4 hours, centrifuge at 4,000 rpm for 5 minutes, remove 800 μL of supernatant, and blow and mix with a sterile pipette tip;
[0193] 5) Apply the remaining suspension on the YEB solid medium plate containing Kana (see Table 1 for the...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


