NtHAK11 gene and application thereof
A kind of use, technology of transgenic plants, applied in the field of genes, can solve the problems of destruction, no significant increase in potassium content of tobacco leaves, and increased consumption of potassium fertilizer resources, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0071] The PCR amplification of embodiment 1 NtHAK11 gene and the construction of pEASY-T1+NtHAK11 recombinant vector
[0072] Primer design and synthesis: respectively design gene-specific primers for gene cloning in common tobacco. The primers were synthesized by Chengdu Qingke Zixi Biotechnology Co., Ltd. Primer sequences (5'to 3') are as follows:
[0073] NtHAK11F CG GGATCC CGATGGCTTCAGCGTTAGGGATGG SEQ ID NO: 3;
[0074] NtHAK11R C GAGCTC GTACATAGAAAATTTGTCCAACGTTCAAG SEQ ID NO:4.
[0075] Among them, the underline in NtHAK11F is the BamHI restriction site, and the underline in NtHAK11R is the SacⅠ restriction site. The primers were synthesized by Chengdu Qingke Zixi Biotechnology Co., Ltd.
[0076] Extraction of total RNA from tobacco: The extraction of total RNA from tobacco plants was carried out with reference to the TIANGEN RNA Pure Plant Kit kit. In order to prevent RNase contamination, the mortar was calcined with alcohol at high temperature and cooled natu...
Embodiment 2
[0137] Example 2 Construction of pC2301M1DPB+NtHAK11 recombinant vector
[0138] The target gene NtHAK11 was constructed into the pC2301M1DPB vector (see figure 2 ).
[0139] The enzyme digestion system for the target gene is:
[0140] Digest the target fragment on the T vector: the enzyme digestion system is as follows:
[0141]
[0142] The vector digestion system is:
[0143]
[0144] Target fragment and vector recovery: the specific steps are the same as above.
[0145] Connection of target fragment and vector:
[0146]
[0147] 37°C, 2h connection.
[0148] The ligation product was transformed into Escherichia coli: the specific steps were the same as above.
[0149] Bacterial liquid PCR identification: the specific steps are the same as above, and the primers used for identification are the primers used for cloning (ie NtHAK11F and NtHAK11R).
[0150] Plasmid extraction steps and sequencing: the specific steps are the same as above.
Embodiment 3
[0151] Example 3 Preparation of recombinant Agrobacterium tumefaciens EHA105-pC2301M1DPB+NtHAK11 cells
[0152] Expression vector transformed into Agrobacterium
[0153] 1) Add 10 μL of plasmid DNA (plasmid DNA of pC2301M1DPB+NtHAK11 recombinant vector obtained in Example 2) to Agrobacterium EH105 competent cells and mix gently;
[0154] 2) Ice bath for 30 minutes, then freeze the competent cells in liquid nitrogen for 8 minutes, then quickly place them in a 37°C water bath for 5 minutes, and then ice-bath for 2 minutes;
[0155] 3) Add 850 μL of antibiotic-free YEB liquid medium on the ultra-clean workbench, mix it upside down, and incubate on a shaker at 225 rpm at 28°C for 4 hours;
[0156] 4) After culturing for 4 hours, centrifuge at 4,000 rpm for 5 minutes, remove 800 μL of supernatant, and blow and mix with a sterile pipette tip;
[0157] 5) Apply the remaining suspension on the YEB solid medium plate containing Kana (see Table 1 for the formula) and rif (see Table 1 fo...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More