Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Preparation method of zebrafish notch1b gene mutant

A technology of zebrafish and mutants, applied in biochemical equipment and methods, other methods of inserting foreign genetic materials, genetic engineering, etc., can solve the problems of expensive mouse model construction and maintenance, and achieve a clear and clean genetic background Effect

Pending Publication Date: 2018-10-26
SHANGHAI OCEAN UNIV
View PDF14 Cites 26 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are currently insufficient studies on Notch1 mutants in mice, and mouse models are expensive to construct and maintain

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of zebrafish notch1b gene mutant
  • Preparation method of zebrafish notch1b gene mutant
  • Preparation method of zebrafish notch1b gene mutant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0044] 1 Materials and equipment

[0045] 1.1 Experimental fish

[0046] The zebrafish used in this experiment were all AB strains, which were purchased from the Zebrafish Platform of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

[0047] 1.2 Plasmid

[0048] pXT7-hCas9 plasmid, pUC19-gRNA scaffold plasmid sourced from literature: Chang N, Sun C, Gao L, Zhu D, Xu X, Zhu X, Xiong JW, Xi JJ. Genome editing with RNA-guided Cas9nucleasein zebrafish embryos, Cell Res , 2013, 23(4): 465-472.

[0049] The pUC19-gRNA scaffold plasmid template sequence used in gRNA product synthesis is:

[0050] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT (SEQ ID NO. 1).

[0051] 1.3 Main reagents

[0052] DNA Clean&Contentrator-5 (ZYMO RESEARCH, D4004), common DNA purification kit (TIANGEN, DP204-03), T7in vitro Transcription Kit (Ambion, AM1314), ethanol (absolute ethanol) (Sinop...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method of a zebrafish notch1b gene mutant. The preparation method includes: determining positions of knock-out target spots of the notch1b gene; utilizing pUC19-gRNA scaffold plasmid as a template, and performing PCR (polymerase chain reaction) amplification with primers T7-notch1b-sfd and tracr rev; subjecting a PCR product to purification and in-vitro transcription to obtain gRNA (guide ribose nucleic acid); introducing the gRNA and Cas9mRNA into a cell-stage embryo of zebrafish, and culturing to obtain the notch1b gene mutant stable in inheritance. Thepreparation method has the advantages that by the aid of the CRISPR / Cas9 (clustered regularly interspersed short palindromic repeats, CRISPR / CRISPR-associated genes, cas gene) technology, and by meansof selecting a specific section of targeting domain, the notch1b gene in the zebrafish is knocked out, other genes are protected from being 'injured accidentally', the zebrafish without the Notch1b gene is formed, and great significance is achieved on study of Notch signal channels.

Description

technical field [0001] The invention relates to a zebrafish mutant, in particular to a method for preparing a zebrafish notch1b gene mutant. Background technique [0002] The Notch signaling pathway is a highly conserved signaling pathway widely present in vertebrate and invertebrate cells, and its receptors are highly structured among different species (from Drosophila to human) and among different members of the same species Homology, the interaction between ligands and receptors outside the adjacent cell membrane to regulate the typical signaling pathways that activate downstream pathways, and together with other signaling pathways constitute a complex and huge network structure. More and more studies have found that the Notch signaling pathway can regulate the immune function of the body by regulating the development and function of various immune cells, and can also directly regulate the expression of immune factors. [0003] CRISPR / Cas (Clustered Regularly Intersperse...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/90C12N9/22A01K67/027
CPCA01K67/0275A01K2217/075A01K2227/40A01K2267/0306C12N9/22C12N15/902
Inventor 张庆华郭欣娅董雪红岳倩文李伟明
Owner SHANGHAI OCEAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com