Preparation method of zebrafish notch1b gene mutant
A technology of zebrafish and mutants, applied in biochemical equipment and methods, other methods of inserting foreign genetic materials, genetic engineering, etc., can solve the problems of expensive mouse model construction and maintenance, and achieve a clear and clean genetic background Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0044] 1 Materials and equipment
[0045] 1.1 Experimental fish
[0046] The zebrafish used in this experiment were all AB strains, which were purchased from the Zebrafish Platform of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.
[0047] 1.2 Plasmid
[0048] pXT7-hCas9 plasmid, pUC19-gRNA scaffold plasmid sourced from literature: Chang N, Sun C, Gao L, Zhu D, Xu X, Zhu X, Xiong JW, Xi JJ. Genome editing with RNA-guided Cas9nucleasein zebrafish embryos, Cell Res , 2013, 23(4): 465-472.
[0049] The pUC19-gRNA scaffold plasmid template sequence used in gRNA product synthesis is:
[0050] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT (SEQ ID NO. 1).
[0051] 1.3 Main reagents
[0052] DNA Clean&Contentrator-5 (ZYMO RESEARCH, D4004), common DNA purification kit (TIANGEN, DP204-03), T7in vitro Transcription Kit (Ambion, AM1314), ethanol (absolute ethanol) (Sinop...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap