Unlock instant, AI-driven research and patent intelligence for your innovation.

Non-treatment-oriented method for constructing zebrafish model used for sifting drugs for treating Parkinson's diseases

A Parkinson's disease and construction method technology, applied in the field of disease animal model construction, to achieve good stability and reliability, improve behavioral activity reduction, and improve the effect of dopamine neuron loss

Active Publication Date: 2018-11-02
HANGZHOU NORMAL UNIVERSITY
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, the retrieval of relevant materials including Chinese patents shows that there is no relevant report on the use of this LRRK2 mutant zebrafish combined with oxidative stress to establish an animal model of Parkinson's disease

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Non-treatment-oriented method for constructing zebrafish model used for sifting drugs for treating Parkinson's diseases
  • Non-treatment-oriented method for constructing zebrafish model used for sifting drugs for treating Parkinson's diseases
  • Non-treatment-oriented method for constructing zebrafish model used for sifting drugs for treating Parkinson's diseases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1 Adding oxidative stress to LRRK2 mutant zebrafish induces loss of dopamine neurons in zebrafish

[0023] 1. LRRK2 mutant zebrafish

[0024] 3 pairs of Zinc Finger Nuclease were purchased from Sigma-Aldrich Company. The first pair of Zinc Finger Nuclease (PZFN1 / PZFN2) showed the highest activity, so PZFN1 / PZFN2 was used to construct the mutant.

[0025]The mutant construction method refers to the scheme of Sigma-Aldrich Company (http: / / www.sigmaaldrich.com / etc / medialib / docs / Sigma / Bulletin / 1 / cstzfnbul.Par.0001.File.tmp / cstzfnbul.pdf) and Foley's (J.E.Foley, M.L.Maeder, J.Pearlberg, J.K.Joung, R.T.Peterson, J.R.Yeh, Targeted mutagenesis in zebrafish using customized zinc-finger nucleases, Nature protocols, 4(2009) 1855-1867.). Primers for genotype identification: 5'GTGTTTCAGGTGTTTGATCGTC3'and 5'AAATGGGAGGAGCTACTCTATG3'. The kit for genotype identification, Phire Animal Tissue direct PCR kit, was purchased from Thermo Scientific. Obtain the mutant ( Figure 4 ...

Embodiment 2

[0028] Example 2 The method of adding oxidative stress to LRRK2 mutant zebrafish induces a decrease in behavioral activity in zebrafish

[0029] When the LRRK2 mutant zebrafish was subjected to oxidative stress at 24hpf (hydrogen peroxide concentration was 1.25mM), it was found that at 6dpf, the LRRK2 mutant zebrafish showed a significant decrease in activity compared to the wild type ( figure 2 ). Rescue with Parkinson's disease drug L-dopa (directly added to hydrogen peroxide solution) at 5dpf, and found that in the concentration range of 0.5-2mM, the rescue effect of L-dopa on the phenotype of reduced activity of the mutant line was not accompanied by a dose-dependent relationship ( image 3 ).

[0030] This zebrafish Parkinson's disease model can be used for high-throughput drug screening based on behavioral analysis. Small molecule compounds and genetically engineered recombinant proteins that have a rescue effect on activity reduction can be further analyzed by dopami...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a non-treatment-oriented method for constructing a zebrafish model used for sifting drugs for treating Parkinson's diseases. The method is characterized in that LRRK2 mutationzebrafish is put in 1-5 mM of a hydrogen peroxide solution, and it takes only 3-6 days to construct the zebrafish model. By means of the method, the model for the Parkinson's diseases is constructed in the zebrafish by combining multiple factors such as genes, environments and ageing, and the Parkinson's diseases are simulated in animals with high fidelity; by using the animal model as a medium, relevant micromolecule compounds and genetic engineering recombinant proteins are sifted, and the drugs which are made from the micromolecule compounds and the genetic engineering recombinant proteinsand can obviously avoid deficiency of dopaminergic neurons and lowering of the behavior activeness are obtained. The sifting method is simple, the cost is low, and the stability and reliability are high.

Description

(1) Technical field [0001] The invention relates to the construction of disease animal models, in particular to a method for constructing a zebrafish model for screening drugs for treating Parkinson's disease for non-therapeutic purposes. (2) Background technology [0002] Parkinson's disease is a common neurodegenerative disease accompanied by the loss of dopaminergic neurons in the substantia nigrapars compacta (Substantia nigrapars compacta). Tremors, the body loses flexibility and becomes stiff. Parkinson's disease is the fourth most common neurodegenerative disease in the elderly. In 2005, there were 4.5 million Parkinson's patients over the age of 50 worldwide. This number will double in 2030. With the aging trend, The population of Parkinson's disease in China has reached more than 2 million, accounting for 1% of the elderly population, and is increasing at a rate of 100,000 per year, but its pathogenic mechanism has not yet been fully elucidated. At present, the an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A01K61/10
CPCA01K61/10Y02A40/81
Inventor 盛东来
Owner HANGZHOU NORMAL UNIVERSITY