Non-treatment-oriented method for constructing zebrafish model used for sifting drugs for treating Parkinson's diseases
A Parkinson's disease and construction method technology, applied in the field of disease animal model construction, to achieve good stability and reliability, improve behavioral activity reduction, and improve the effect of dopamine neuron loss
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Example 1 Adding oxidative stress to LRRK2 mutant zebrafish induces loss of dopamine neurons in zebrafish
[0023] 1. LRRK2 mutant zebrafish
[0024] 3 pairs of Zinc Finger Nuclease were purchased from Sigma-Aldrich Company. The first pair of Zinc Finger Nuclease (PZFN1 / PZFN2) showed the highest activity, so PZFN1 / PZFN2 was used to construct the mutant.
[0025]The mutant construction method refers to the scheme of Sigma-Aldrich Company (http: / / www.sigmaaldrich.com / etc / medialib / docs / Sigma / Bulletin / 1 / cstzfnbul.Par.0001.File.tmp / cstzfnbul.pdf) and Foley's (J.E.Foley, M.L.Maeder, J.Pearlberg, J.K.Joung, R.T.Peterson, J.R.Yeh, Targeted mutagenesis in zebrafish using customized zinc-finger nucleases, Nature protocols, 4(2009) 1855-1867.). Primers for genotype identification: 5'GTGTTTCAGGTGTTTGATCGTC3'and 5'AAATGGGAGGAGCTACTCTATG3'. The kit for genotype identification, Phire Animal Tissue direct PCR kit, was purchased from Thermo Scientific. Obtain the mutant ( Figure 4 ...
Embodiment 2
[0028] Example 2 The method of adding oxidative stress to LRRK2 mutant zebrafish induces a decrease in behavioral activity in zebrafish
[0029] When the LRRK2 mutant zebrafish was subjected to oxidative stress at 24hpf (hydrogen peroxide concentration was 1.25mM), it was found that at 6dpf, the LRRK2 mutant zebrafish showed a significant decrease in activity compared to the wild type ( figure 2 ). Rescue with Parkinson's disease drug L-dopa (directly added to hydrogen peroxide solution) at 5dpf, and found that in the concentration range of 0.5-2mM, the rescue effect of L-dopa on the phenotype of reduced activity of the mutant line was not accompanied by a dose-dependent relationship ( image 3 ).
[0030] This zebrafish Parkinson's disease model can be used for high-throughput drug screening based on behavioral analysis. Small molecule compounds and genetically engineered recombinant proteins that have a rescue effect on activity reduction can be further analyzed by dopami...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


