Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

VZV recombinant gE-flagellin fusion protein as well as preparation method and application thereof

A fusion protein, flagellin technology, applied in biochemical equipment and methods, fusion polypeptide, recombinant DNA technology, etc., can solve the problem of not making substantial progress, and achieve a good immunological foundation, good immune activity, and high antibody drop. degree of effect

Pending Publication Date: 2018-11-02
BRAVOVAX
View PDF7 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In terms of varicella vaccine, some scholars have been working on the expression of gE protein by fusion protein, but no substantial progress has been made

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • VZV recombinant gE-flagellin fusion protein as well as preparation method and application thereof
  • VZV recombinant gE-flagellin fusion protein as well as preparation method and application thereof
  • VZV recombinant gE-flagellin fusion protein as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] 1. Design and synthesis of primers

[0061] According to the sequence of Oka strain VZV glycoprotein gE and Salmonella flagellin protein gene sequence in NCBI, the design was optimized, the sequence of flagellin DNA conservation region and the truncation and splicing of the connecting sequence were selected, and it was constructed on the pET28a vector, named pET28a-gE-flagella white.

[0062] The sequences involved are as follows:

[0063] The gE protein DNA sequence is shown in the sequence table SEQ ID NO: 1, specifically as follows:

[0064] ATGGGGACAGTTAATAAACCTGTGGTGGGGGTATTGATGGGGTTCGGAATTATCACGGGAACGTTGCGTATAACGAATCCGGTCAGAGCATCCGTCTTGCGATACGATGATTTTCACATCGATGAAGACAAACTGGATACAAACTCCGTATATGAGCCTTACTACCATTCAGATCATGCGGAGTCTTCATGGGTAAATCGGGGAGAGTCTTCGCGAAAAGCGTACGATCATAACTCACCTTATATATGGCCACGTAATGATTATGATGGATTTTTAGAGAACGCACACGAACACCATGGGGTGTATAATCAGGGCCGTGGTATCGATAGCGGGGAACGGTTAATGCAACCCACACAAATGTCTGCACAGGAGGATCTTGGGGACGATACGGGCATCCACGTTATCCCTACGTTAAACGGCGATGACAGACAT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a VZV recombinant gE-flagellin fusion protein as well as a preparation method and application thereof. The fusion protein at least comprises an N-end conserved region of flagellin protein, varicella zoster virus (VZV) glycoprotein gE and a C-end conserved region of the flagellin protein. Compared with an independently pre-recombinant gE protein, the VZV recombinant gE-flagellin fusion protein provided by the invention can cause higher antibody titer, so that immunological competence is relatively good, cell-mediated immunity and humoral immunity can be motivated, and therefore, the VZV recombinant gE-flagellin fusion protein does not have a potential infection risk, and a good immunological basis is laid for preparing a novel varicella protein vaccine.

Description

technical field [0001] The invention relates to a VZV recombinant gE-flagellin fusion protein and its preparation method and application, belonging to the field of biopharmaceuticals, especially the field of genetic engineering vaccines. Background technique [0002] 1. Overview of varicella-zoster virus [0003] Primary infection with varicella-zoster virus (VZV) can cause chickenpox (chickenpox) and herpes zoster (HZ), with high infectivity and morbidity. Chickenpox is an acute and highly contagious disease that is common in childhood. Children develop generalized rashes, accompanied by fever and malaise. Herpes zoster often occurs in middle-aged and elderly people. It is a vesicular disease that appears in the dermatome and is characterized by nerve pain and cutaneous eruption with unilateral distribution of nerve branches. These two diseases have different clinical manifestations, but are caused by the same virus, the varicella-zoster virus. VZV infects the human body...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/70C12N15/62A61K39/25A61P31/22
CPCA61K39/12A61K2039/55516C07K14/005C07K14/255C07K2319/00C12N2710/16722C12N2710/16734
Inventor 肖杨刘昊智毛普加高媛王雨李津吴克
Owner BRAVOVAX
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com