VZV recombinant gE-flagellin fusion protein as well as preparation method and application thereof
A fusion protein, flagellin technology, applied in biochemical equipment and methods, fusion polypeptide, recombinant DNA technology, etc., can solve the problem of not making substantial progress, and achieve a good immunological foundation, good immune activity, and high antibody drop. degree of effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0060] 1. Design and synthesis of primers
[0061] According to the sequence of Oka strain VZV glycoprotein gE and Salmonella flagellin protein gene sequence in NCBI, the design was optimized, the sequence of flagellin DNA conservation region and the truncation and splicing of the connecting sequence were selected, and it was constructed on the pET28a vector, named pET28a-gE-flagella white.
[0062] The sequences involved are as follows:
[0063] The gE protein DNA sequence is shown in the sequence table SEQ ID NO: 1, specifically as follows:
[0064] ATGGGGACAGTTAATAAACCTGTGGTGGGGGTATTGATGGGGTTCGGAATTATCACGGGAACGTTGCGTATAACGAATCCGGTCAGAGCATCCGTCTTGCGATACGATGATTTTCACATCGATGAAGACAAACTGGATACAAACTCCGTATATGAGCCTTACTACCATTCAGATCATGCGGAGTCTTCATGGGTAAATCGGGGAGAGTCTTCGCGAAAAGCGTACGATCATAACTCACCTTATATATGGCCACGTAATGATTATGATGGATTTTTAGAGAACGCACACGAACACCATGGGGTGTATAATCAGGGCCGTGGTATCGATAGCGGGGAACGGTTAATGCAACCCACACAAATGTCTGCACAGGAGGATCTTGGGGACGATACGGGCATCCACGTTATCCCTACGTTAAACGGCGATGACAGACAT...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap