Method for detecting biological activity of RANKL (receptor activator for nuclear factor-KB ligands) targeted therapy medicines
A biologically active and targeted therapy technology, applied in the field of detecting the biological activity of RANKL targeted therapy drugs, can solve the problems of time-consuming, small detection window, and insignificant induction effect, and achieve the effect of simple and easy method.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0027] The technical solutions of the present invention will be further described below with reference to specific embodiments and drawings, but the protection scope of the present invention is not limited. Unless otherwise specified, the reagents and instruments used in the following examples can be obtained through commercial channels. For the sake of brevity, the details of some conventional technical operations in the following embodiments are not described, but it can be understood that they fall within the scope that those skilled in the art can know and implement.
[0028] Construction of NF-kB binding sequence as the promoter of Luciferase
[0029] Design 5 NF-kB binding sites, the sequence is:
[0030] GGGAATTTCCGGGAATTTCCGGGAATTTCCGGGAATTTCCGGGAATTTCCGGGAATTTCC (SEQ IDNO.1)
[0031] It is worth noting that the increase to 6 binding sites here is to increase the binding domain of the NF-kB protein and allow protein binding.
[0032] The introduction sites are XhoI at the 5'e...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


