Method for detecting biological activity of RANKL (receptor activator for nuclear factor-KB ligands) targeted therapy medicines

A biologically active and targeted therapy technology, applied in the field of detecting the biological activity of RANKL targeted therapy drugs, can solve the problems of time-consuming, small detection window, and insignificant induction effect, and achieve the effect of simple and easy method.

Inactive Publication Date: 2018-11-06
GUANGDONG ANNPO BIOTECHNOLOGY INC
View PDF8 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The main disadvantages of this detection method are: 1. Time-consuming, it needs to be induced for up to 5 to 10 days, and the cells need to be replaced and various pharmaceutical ingredients are added in the middle; In terms of percentage, the difference between negative control and positive control is between 100%-300%, and the detection window is small

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting biological activity of RANKL (receptor activator for nuclear factor-KB ligands) targeted therapy medicines
  • Method for detecting biological activity of RANKL (receptor activator for nuclear factor-KB ligands) targeted therapy medicines
  • Method for detecting biological activity of RANKL (receptor activator for nuclear factor-KB ligands) targeted therapy medicines

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0027] The technical solutions of the present invention will be further described below with reference to specific embodiments and drawings, but the protection scope of the present invention is not limited. Unless otherwise specified, the reagents and instruments used in the following examples can be obtained through commercial channels. For the sake of brevity, the details of some conventional technical operations in the following embodiments are not described, but it can be understood that they fall within the scope that those skilled in the art can know and implement.

[0028] Construction of NF-kB binding sequence as the promoter of Luciferase

[0029] Design 5 NF-kB binding sites, the sequence is:

[0030] GGGAATTTCCGGGAATTTCCGGGAATTTCCGGGAATTTCCGGGAATTTCCGGGAATTTCC (SEQ IDNO.1)

[0031] It is worth noting that the increase to 6 binding sites here is to increase the binding domain of the NF-kB protein and allow protein binding.

[0032] The introduction sites are XhoI at the 5'e...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a method for detecting the biological activity of RANKL (receptor activator for nuclear factor-KB ligands) targeted therapy medicines. The method includes steps of firstly, constructing transcription factor NF-kB (nuclear factor-kB) binding sequences, cloning the NF-kB binding sequences into luciferase reporter gene carriers, and guiding luciferase reporter gene transcription by the aid of the NF-kB binding sequences used as components of starters so as to obtain plasmids with the NF-kB binding sequences and luciferase reporter genes; secondly, transfecting cells by theplasmids with the NF-kB binding sequences and the luciferase reporter genes; thirdly, vaccinating the cells, adding RANKL and the RANKL targeted therapy medicines into the cells and then culturing thecells; fourthly, lysing the cells, adding luciferase substrates into the cells and detecting the fluorescence intensity so as to determine the biological activity of the RANKL targeted therapy medicines. The method has the advantage that the biological activity of the denosumab RANKL targeted therapy medicines can be accurately, easily, feasibly and quickly detected by the aid of the method.

Description

Technical field [0001] The invention belongs to the field of biological detection, and specifically relates to a method for detecting the biological activity of RANKL targeted therapy drugs. Background technique [0002] The monoclonal antibody Denosumab (Denosumab hereinafter referred to as Denosumab, trade name Erbitux, a product listed by Amgen) for the treatment of osteoporosis and bone cancer metastasis is achieved by blocking RANKL (Receptor Activator for NuclearFactor-kB Ligand, The biological activity of the nuclear factor kB receptor activator ligand) protein plays a role. When RNAKL binds to its receptor RANK protein, it activates a series of transcription factors and induces gene transcription through signal transduction. Some of these genes induced to be transcribed are involved in inducing the differentiation and maturation of osteoclasts and in inducing the metastasis of bone cancer cells. [0003] The transcription factor NF-kB is a key transcription factor that ha...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/66
CPCC12Q1/66
Inventor 叶才果梁桂婵邓新宇王笑非
Owner GUANGDONG ANNPO BIOTECHNOLOGY INC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products