Unlock instant, AI-driven research and patent intelligence for your innovation.

Multiplex PCR detection kit and detection method for detecting thirteen types of transgenic soybeans

A technology of genetically modified soybeans and kits, which is applied in biochemical equipment and methods, recombinant DNA technology, measurement/inspection of microorganisms, etc., can solve the problem of unsuitable detection conditions, inability to accurately detect transgenic soybean strains, and inability to detect 13 species and other problems, to achieve the effect of reducing non-specific products, saving reagent usage, and reducing detection costs

Active Publication Date: 2018-11-23
苏州市食品检验检测中心 +1
View PDF3 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The detection methods released by the Chinese Ministry of Agriculture for these genetically modified soybean strains are mainly based on nucleic acid detection, but all of these methods can only perform single-plex PCR detection on one genetically modified soybean strain
The inventor's research group has designed a multiplex PCR detection system mediated by public primers for 12 genetically modified soybean strains; however, in 2017, the Ministry of Agriculture of my country issued an approval for the import of MON87705 genetically modified soybean strains. The multiplex PCR system cannot detect all the genetically modified strains stipulated by the Ministry of Agriculture of my country at one time. At the same time, due to the increase of new components, the existing detection conditions are not applicable. GM soybean lines cannot be accurately detected

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multiplex PCR detection kit and detection method for detecting thirteen types of transgenic soybeans
  • Multiplex PCR detection kit and detection method for detecting thirteen types of transgenic soybeans
  • Multiplex PCR detection kit and detection method for detecting thirteen types of transgenic soybeans

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] The specificity of embodiment one common primer

[0055] The present invention uses a common primer (UP, universal primer)-mediated multiplex PCR (UP-MPCR) detection scheme, that is, adding the same common primer to the 5' end of the specific upstream and downstream primers to form a chimeric primer, which is different from the prior art The system will have fewer problems than adding 2 common primers. In the multiplex PCR system mediated by public primers, there are low concentration of chimeric primers and high concentration of public primers. In the early stage of amplification, high / low annealing temperature PCR is performed. At this time, the chimeric primers play a role and amplify by combining with the template. The first PCR product containing common primers is generated. As the cycle progresses, the low-concentration chimeric primers are quickly consumed. When the cycle progresses to the later stage, the annealing temperature is low. At this time, only the comm...

Embodiment 2

[0060] A multiplex PCR kit for detecting transgenic soybeans, including conventional multiplex PCR components, also includes chimeric primers and public primers for transgenic soybeans; the sequences of chimeric primers and public primers are shown in Table 1, and conventional multiplex PCR components include Taq polymerase, dNTP, MgCl 2 , PCR buffer, deionized water, positive control primer pair;

[0061] Positive control positive primer SEQ ID NO.24, positive control reverse primer SEQ ID NO.25, the product length is 210bp; can be used to detect DNA template quality and reaction system amplification efficiency; SEQ ID NO.24: GGGTGAGGATAGGGTTCTCTG; SEQ ID NO .25: GCGATCGAGTAGTGAGAGTCG.

[0062] Table 1 Chimeric primers and public primers for 13 transgenic soybeans imported from my country

[0063]

[0064] Only by combining the common primers, the nucleotide sequences shown in SEQ ID NO.14 to SEQ ID NO.15, and conventional multiplex PCR components, an ordinary PCR kit fo...

Embodiment 3

[0065] Example 3 Specificity and Sensitivity Detection of Chimeric Primers

[0066] In the nucleic acid detection of transgenic components, according to the position of the amplified target sequence, the detection specificity varies greatly, which can be divided into screening detection, gene-specific detection, construction-specific detection and strain-specific detection, among which strain-specific The detection has the highest specificity.

[0067] The specificity of chimeric primers was detected by the method of single primer and multiple templates. The mixed template is to mix 11 kinds of transgenic soybean genomic DNA (both at a concentration of 25ng / ul), take 4ul as a PCR template, and test the specificity of each pair of specific chimeric primers. The PCR program is shown in Table 2, and the specific PCR reaction system See Table 3.

[0068] Table 2 PCR program

[0069]

[0070] Table 3 PCR reaction system

[0071]

[0072] The final concentration of the pub...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a multiplex PCR detection kit and a detection method for detecting thirteen types of transgenic soybeans. The multiplex PCR detection kit is capable of rapidly detecting thirteen types of transgenic soybeans imported under approval of the Ministry of Agriculture of China and comprises MON87701, GTS40-3-2, MON89788, CV127, A2704, A5547, DP356043, DP305423, MON87769, MON87708, 305423*40-3-2, MON87701*MON89788 and MON87705. The multiplex PCR detection kit is based on a multiplex PCR method mediated by a public primer and comprises detection of the public primer, a multipleprimer and a multiplex PCR system; a newly-designed annealing temperature method is used for improving specificity and sensitivity of the multiplex PCR system. The multiplex PCR method has inclusiveness; detection targets can be continuously increased; the detection throughput of multiplex PCR can be improved; the multiplex PCR detection kit has the advantages of high sensitivity, economy, rapidspeed and simplicity in operation, and can be applied to food detection.

Description

technical field [0001] The invention belongs to the field of food / gene detection, and in particular relates to a multiplex PCR kit and a detection method for detection of transgenic soybeans, in particular to a multiplex PCR kit and detection method for detection of thirteen kinds of genetically modified soybeans. technical background [0002] Transgenic crops are bred by transferring foreign target genes into plants by using genetic engineering technology. They have excellent characteristics such as insect resistance, herbicide resistance, stress resistance and nutritional improvement. The global acreage of biotech crops increased from 17 million hectares in 1996 to 179.7 million hectares in 2015. With the continuous development of genetically modified technology, the degree of industrialization and commercialization of genetically modified crops continues to deepen, and my country has successively formulated relevant laws and regulations for genetically modified crops. The...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12Q1/686C12N15/11
CPCC12Q1/686C12Q1/6895C12Q2600/16C12Q2537/143
Inventor 薛满孙万平王晓囡沈苏南刘婉婉陶静马建婷
Owner 苏州市食品检验检测中心