Multiplex PCR detection kit and detection method for detecting thirteen types of transgenic soybeans
A technology of genetically modified soybeans and kits, which is applied in biochemical equipment and methods, recombinant DNA technology, measurement/inspection of microorganisms, etc., can solve the problem of unsuitable detection conditions, inability to accurately detect transgenic soybean strains, and inability to detect 13 species and other problems, to achieve the effect of reducing non-specific products, saving reagent usage, and reducing detection costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0054] The specificity of embodiment one common primer
[0055] The present invention uses a common primer (UP, universal primer)-mediated multiplex PCR (UP-MPCR) detection scheme, that is, adding the same common primer to the 5' end of the specific upstream and downstream primers to form a chimeric primer, which is different from the prior art The system will have fewer problems than adding 2 common primers. In the multiplex PCR system mediated by public primers, there are low concentration of chimeric primers and high concentration of public primers. In the early stage of amplification, high / low annealing temperature PCR is performed. At this time, the chimeric primers play a role and amplify by combining with the template. The first PCR product containing common primers is generated. As the cycle progresses, the low-concentration chimeric primers are quickly consumed. When the cycle progresses to the later stage, the annealing temperature is low. At this time, only the comm...
Embodiment 2
[0060] A multiplex PCR kit for detecting transgenic soybeans, including conventional multiplex PCR components, also includes chimeric primers and public primers for transgenic soybeans; the sequences of chimeric primers and public primers are shown in Table 1, and conventional multiplex PCR components include Taq polymerase, dNTP, MgCl 2 , PCR buffer, deionized water, positive control primer pair;
[0061] Positive control positive primer SEQ ID NO.24, positive control reverse primer SEQ ID NO.25, the product length is 210bp; can be used to detect DNA template quality and reaction system amplification efficiency; SEQ ID NO.24: GGGTGAGGATAGGGTTCTCTG; SEQ ID NO .25: GCGATCGAGTAGTGAGAGTCG.
[0062] Table 1 Chimeric primers and public primers for 13 transgenic soybeans imported from my country
[0063]
[0064] Only by combining the common primers, the nucleotide sequences shown in SEQ ID NO.14 to SEQ ID NO.15, and conventional multiplex PCR components, an ordinary PCR kit fo...
Embodiment 3
[0065] Example 3 Specificity and Sensitivity Detection of Chimeric Primers
[0066] In the nucleic acid detection of transgenic components, according to the position of the amplified target sequence, the detection specificity varies greatly, which can be divided into screening detection, gene-specific detection, construction-specific detection and strain-specific detection, among which strain-specific The detection has the highest specificity.
[0067] The specificity of chimeric primers was detected by the method of single primer and multiple templates. The mixed template is to mix 11 kinds of transgenic soybean genomic DNA (both at a concentration of 25ng / ul), take 4ul as a PCR template, and test the specificity of each pair of specific chimeric primers. The PCR program is shown in Table 2, and the specific PCR reaction system See Table 3.
[0068] Table 2 PCR program
[0069]
[0070] Table 3 PCR reaction system
[0071]
[0072] The final concentration of the pub...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


