Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

An indirect ELISA method for the detection of duck reovirus that causes duck spleen necrosis

A technology of duck reo and virus, applied in the field of indirect ELISA detection of duck reovirus, can solve the problems of increased duck feed-to-meat ratio, lack of vaccine immunization and prevention and control measures, and reduced slaughter qualification rate of meat ducks.

Active Publication Date: 2021-04-30
SHANDONG AGRICULTURAL UNIVERSITY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The feed-to-meat ratio of ducks increases, and the pass rate of meat ducks drops significantly, causing serious economic losses to the meat duck and duck breeding industry
[0004] Studies have confirmed that the pathogen of this high-incidence duck infectious disease with spleen necrosis as the main symptom is a new type of duck reovirus, which is a new infectious disease. Research is still in its infancy, and there is still a lack of effective vaccine immunization and preventive control measures, and no serological detection method for this new virus has yet been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • An indirect ELISA method for the detection of duck reovirus that causes duck spleen necrosis

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0042](1) Preparation of coated antigen:

[0043] The whole gene sequence of the new duck reovirus was obtained by next-generation sequencing technology. The sequences of the 10 gene fragments L1, L2, L3, M1, M2, M3, S1, S2, S3, and S4 in the whole genome sequence are shown in SEQ Shown in ID NO.3-SEQ ID NO.12. According to the obtained σC protein gene sequence of the novel duck reovirus, two primers were designed:

[0044] Upstream primer σC-F:5 ， - ATACGCCTGATACTTTCCCT -3 ’

[0045] Downstream primer σC-R:5 ’ - GCGCAATGAGAAGAGCTATTCATC -3 ’ .

[0046] Use the above primers to amplify the cDNA obtained by reverse transcription through the common PCR method to amplify the σC gene sequence (shown in SEQ ID NO.13) with a length of 980 bp, and purify it by gel electrophoresis and gel recovery. The purified The cDNA was cloned into the prokaryotic expression vector PET-28a(+) to construct the recombinant prokaryotic expression vector PET28a-σC; the recombinant prokaryotic e...

Embodiment 1

[0071] Example 1: Preparation of Coated Antigen

[0072] 1.1 Design and synthesis of specific primers: A pair of primers were designed according to the σC protein coding region of the whole gene sequence of the new duck reovirus (preservation number: CCTCC NO: V201843), and the two primers were respectively equipped with BamHI and SalⅠ restriction sites , it is estimated that a 980bp gene fragment in the genome of the novel duck reovirus can be amplified.

[0073] Upstream primer σC-F:5 ， - ATACGCCTGATACTTTCCCT -3 ’ ;

[0074] Downstream primer σC-R:5 ’ - GCGCAATGAGAAGAGCTATTCATC -3 ’ .

[0075] 1.2 Construction of PET28a-σC prokaryotic expression vector:

[0076] The σC gene fragment was amplified by PCR using specific upstream and downstream primers, the purified fragment was ligated with the PMD18-T vector, the ligated product was transformed into DH5α competent cells, and positive colonies were picked and shaken to extract the T-σ recombinant plasmid. The T-σ recomb...

Embodiment 2

[0084] Embodiment 2: Indirect ELISA detection novel duck reovirus antibody

[0085] The purified recombinant protein σC in Example 1 was used as the coating antigen to establish an indirect ELISA method, and the square array method was used to explore the optimal protein coating concentration and serum dilution concentration for ELISA, as well as the optimal reaction conditions for ELISA. The final conditions are as follows:

[0086] 2.1 Coating: After the antigen is diluted 1:1000 with 1×carbonate buffer (pH=9.6), take 10 μL and coat it in a 96-well ELISA plate, wrap it in plastic wrap, incubate at 37°C for 2 hours, and use 0.05% Wash with Tween PBST three times, 4 min each time. Detection hole σC protein coating amount 500ng / well;

[0087] 2.2 Sealing: Dilute 5% skimmed milk powder with PBST to 200 μL / well, incubate at 37°C for 1 hour, then spin dry, wash with PBST 3 times, 4 minutes each time;

[0088] 2.3 Serum action conditions: add 10 μL of the serum to be tested and ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses an indirect ELISA detection kit for detecting novel duck reovirus antibody. The preparation method of the recombinant antigen of the orphan virus σC protein is as follows: the whole gene sequence of the duck reovirus with the preservation number CCTCC NO: V201843 is used as a template, the σC gene fragment is obtained by amplifying the primer pair, and the recombinant expression vector is constructed and expressed by prokaryotic The system expresses the recombinant antigen of duck reovirus σC protein. The indirect ELISA detection kit of the present invention can quickly and effectively detect the new outbreak of new duck reovirus antibody with spleen necrosis as the main symptom, so as to monitor the prevalence of the new duck reovirus in duck flocks.

Description

technical field [0001] The invention relates to the technical field of biological products, in particular to an indirect ELISA detection method for duck reovirus that causes duck spleen necrosis. Background technique [0002] Avian reovirus belongs to the genus Orthoreovirus of the Reovirdae family and can cause a variety of diseases in poultry. Its clinical manifestations vary depending on the virus strain, virulence or infected host. . [0003] Since 2017, a large-scale outbreak of infectious diseases with spleen necrosis as the main symptom has occurred in land ducks in Shandong, Hebei, Henan, Jiangsu, Anhui and other places in my country. The disease mainly causes spleen enlargement, hemorrhage and necrosis in ducks of all ages, resulting in Egg-laying and meat ducks lost their appetite, became thin, and had poor growth and development. Several necrotic lesions, swelling, hemorrhage, and edge hyperplasia appeared in the spleen. The feed-to-meat ratio of ducks increases,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): G01N33/569G01N33/535G01N33/558
CPCG01N33/535G01N33/558G01N33/56983
Inventor 刁有祥唐熠王鸿志
Owner SHANDONG AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com