An indirect ELISA method for the detection of duck reovirus that causes duck spleen necrosis
A technology of duck reo and virus, applied in the field of indirect ELISA detection of duck reovirus, can solve the problems of increased duck feed-to-meat ratio, lack of vaccine immunization and prevention and control measures, and reduced slaughter qualification rate of meat ducks.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0042](1) Preparation of coated antigen:
[0043] The whole gene sequence of the new duck reovirus was obtained by next-generation sequencing technology. The sequences of the 10 gene fragments L1, L2, L3, M1, M2, M3, S1, S2, S3, and S4 in the whole genome sequence are shown in SEQ Shown in ID NO.3-SEQ ID NO.12. According to the obtained σC protein gene sequence of the novel duck reovirus, two primers were designed:
[0044] Upstream primer σC-F:5 , - ATACGCCTGATACTTTCCCT -3 ’
[0045] Downstream primer σC-R:5 ’ - GCGCAATGAGAAGAGCTATTCATC -3 ’ .
[0046] Use the above primers to amplify the cDNA obtained by reverse transcription through the common PCR method to amplify the σC gene sequence (shown in SEQ ID NO.13) with a length of 980 bp, and purify it by gel electrophoresis and gel recovery. The purified The cDNA was cloned into the prokaryotic expression vector PET-28a(+) to construct the recombinant prokaryotic expression vector PET28a-σC; the recombinant prokaryotic e...
Embodiment 1
[0071] Example 1: Preparation of Coated Antigen
[0072] 1.1 Design and synthesis of specific primers: A pair of primers were designed according to the σC protein coding region of the whole gene sequence of the new duck reovirus (preservation number: CCTCC NO: V201843), and the two primers were respectively equipped with BamHI and SalⅠ restriction sites , it is estimated that a 980bp gene fragment in the genome of the novel duck reovirus can be amplified.
[0073] Upstream primer σC-F:5 , - ATACGCCTGATACTTTCCCT -3 ’ ;
[0074] Downstream primer σC-R:5 ’ - GCGCAATGAGAAGAGCTATTCATC -3 ’ .
[0075] 1.2 Construction of PET28a-σC prokaryotic expression vector:
[0076] The σC gene fragment was amplified by PCR using specific upstream and downstream primers, the purified fragment was ligated with the PMD18-T vector, the ligated product was transformed into DH5α competent cells, and positive colonies were picked and shaken to extract the T-σ recombinant plasmid. The T-σ recomb...
Embodiment 2
[0084] Embodiment 2: Indirect ELISA detection novel duck reovirus antibody
[0085] The purified recombinant protein σC in Example 1 was used as the coating antigen to establish an indirect ELISA method, and the square array method was used to explore the optimal protein coating concentration and serum dilution concentration for ELISA, as well as the optimal reaction conditions for ELISA. The final conditions are as follows:
[0086] 2.1 Coating: After the antigen is diluted 1:1000 with 1×carbonate buffer (pH=9.6), take 10 μL and coat it in a 96-well ELISA plate, wrap it in plastic wrap, incubate at 37°C for 2 hours, and use 0.05% Wash with Tween PBST three times, 4 min each time. Detection hole σC protein coating amount 500ng / well;
[0087] 2.2 Sealing: Dilute 5% skimmed milk powder with PBST to 200 μL / well, incubate at 37°C for 1 hour, then spin dry, wash with PBST 3 times, 4 minutes each time;
[0088] 2.3 Serum action conditions: add 10 μL of the serum to be tested and ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 

