Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer, probe, kit and method for detecting transgenic rape Oxy-235

A technology for detecting oxy-235 and primers, which is applied in the field of molecular biology, can solve the problems that there are no detection methods and kits for detecting transgenic rapeseed Oxy-235, and achieve the effect of simple operation and strong specificity

Inactive Publication Date: 2019-01-04
ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no detection method and kit for detecting transgenic rape Oxy-235 by RPA method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, probe, kit and method for detecting transgenic rape Oxy-235

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1 Design and Screening of Transgenic Rapeseed Oxy-235 RPA Detection Primers and Probes

[0029] In the present invention, the target region detected by Oxy-235 RPA is the transformant-specific sequence of Oxy-235, that is, the sequence of the junction region between the foreign source insert and the rapeseed genome, wherein the forward and reverse primers are respectively located on both sides of the junction, and Probes cover the connection area.

[0030] (1) Primer design

[0031] 5 primers were respectively designed on both sides of the connection point, and the length of the primers was 30-32bp. The sequences of the screening primers of the present invention are as follows:

[0032] F1: TCCTAGTTTTGCGCGCTATATTTTGTTTTCT;

[0033] F2:ATCGCGTATTAAATGTATAATTGCGGGACT;

[0034] F3:CTAATCATAAAAAACCCATCTCATAAATAAC;

[0035] F4: TTGCGGGACTCTAATCATAAAAACCCATCT;

[0036] F5:AAATGTATAATTGCGGGACTCTAATCATAA;

[0037] R1: TTAAAACGCGAAGCCATCGCTTTAACCCGT;

[0038] R2: ...

Embodiment 2

[0047] The optimization of embodiment 2RPA reaction system

[0048] (1) Determination of amplification temperature

[0049] Under the condition that other amplification conditions of RPA are the same, carry out RPA amplification in the temperature range of 30-45°C, determine the optimal amplification temperature of RPA according to the strength of the fluorescence signal intensity at different temperatures, and finally determine the optimal amplification The temperature was 39°C.

[0050] (2) Determine the concentration of primers and probes

[0051] Primers and probes were prepared at the same concentration, 10 μmol / L, and other amplification conditions of RPA were the same. Amplification was performed at the optimum amplification temperature of 39°C, and primers and probe combinations with different concentrations were amplified. The strength of the fluorescent signal intensity under the combination determines the optimal primer and probe concentration of RPA, and finally ...

Embodiment 3

[0052] The establishment of embodiment 3 kit and detection method thereof

[0053] The RPA detection kit of transgenic rapeseed Oxy-235 was prepared according to the following formula, and the specification of each kit was 50 reactions:

[0054] (1) Detection primer and probe solution: Synthesize forward primer F, reverse primer R and probe P, and prepare the dry powder of primer and probe with sterilized deionized water or ultrapure water with a concentration of 10 μmol / L respectively. Mother liquor, wherein the primer sequences are:

[0055] Forward primer F: TCCTAGTTTGCGCGCTATATTTTGTTTTCT (SEQ ID NO: 1);

[0056] Reverse primer R: CCGGTACCGGGCATGCAAGCTTGGGCTGCA (SEQ ID NO: 2);

[0057] Probe P:

[0058] TCATGCATTACATGTTAATTATTACATGCT[FAM-dT]AA[THF]G[BHQ1-dT]AATTCAACAGAAA-C3-Spacer (SEQ ID NO: 3).

[0059] (2) Buffer A (1.5mL): containing 50mmol / L Tris-HCl, pH 8.4, 80mmol / L KAc, 2mmol / LDTT, 3mmol / L ATP, 200μmol / L dNTPs, 20mmol / L C 4 h 10 N 3 o 5 P, 100ng / μL creatine ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an RPA detection primer and probe combination, a kit and a detection method of transgenic rape Oxy-235. A primer set consists of two specific primers, the nucleotide sequence of the primer set is shown in SEQ ID No:1-2, and the probe sequence is shown in SEQ ID No.3. The detection kit comprises a detection primer, a probe solution, Buffer A, Buffer B and a positive control.The detection method adopts a specific primer and a probe to amplify a sample DNA template at 37-42 DEG C under the action of recombinase, single-stranded DNA binding protein (SSB), strand displacement DNA polymerase and nucleic acid exonuclease, and judges whether the sample contains a transgenic rape Oxy-235 component through a probe fluorescence signal collection method. The method provided bythe invention does not need special instruments, has the characteristics of high speed and efficiency, simple and convenient operation, high sensitivity, strong specificity and the like, and is suitable for on-site detection.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and relates to a detection method for transgenic plants and products thereof, in particular to a primer and a probe for rapidly detecting transgenic rapeseed Oxy-235 using recombinase polymerase amplification technology (Recombinase Polymerase Amplification, RPA) Assemblies, kits and assays. Background technique [0002] In 2016, the global planting area of ​​genetically modified crops reached 185.1 million hectares, an increase of more than 100 times compared with the initial commercialization in 1996. Currently commercially grown genetically modified crops mainly include soybeans, corn, cotton, and rapeseed. Transgenic rapeseed Oxy-235 is a herbicide-resistant genetically modified rapeseed developed by Bayer, which has been approved by the Chinese government to be imported as a processing raw material. Research on rapid and accurate detection methods for transgenic rapeseed Oxy-235 ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6844C12Q1/6895C12N15/11
CPCC12Q1/6844C12Q1/6895C12Q2521/507C12Q2531/119C12Q2537/1376C12Q2563/107C12Q2522/101
Inventor 徐俊锋汪小福陈笑芸彭城徐晓丽魏巍
Owner ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com