Application of tppi gene in regulating plant stomatal opening and improving plant drought resistance

A transgenic plant, drought-resistant technology, applied in the biological field, can solve problems such as no reports

Active Publication Date: 2021-09-14
FUJIAN AGRI & FORESTRY UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] TPPI Studies on the regulation of trehalose synthesis and the improvement of plant drought resistance have not been reported yet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of tppi gene in regulating plant stomatal opening and improving plant drought resistance
  • Application of tppi gene in regulating plant stomatal opening and improving plant drought resistance
  • Application of tppi gene in regulating plant stomatal opening and improving plant drought resistance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Embodiment 1, TPPI cDNA gene cloning

[0034] (1) Design and synthesis of primers

[0035] according to TPPI The CDS sequence of the gene is used to design primers with Gateway adapters, and the primer sequences are:

[0036] SEQ ID No.3: Forward primer

[0037] 5'- GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGTGCGTTTTGTCGTGGAA-3'

[0038]SEQ ID No.4: reverse primer

[0039] 5'- GGGGACCACTTTGTACAAGAAAGCTGGGTCTCACATTCTTGGCTGCATTTGT-3'

[0040] (2) Extract wild-type Arabidopsis, namely Arabidopsis Col-0 ecotype ( Arabidopsis thaliana , Columbiaecotype) (hereinafter referred to as Col) total RNA, obtained Arabidopsis cDNA by reverse transcription, using Arabidopsis cDNA as a template, and the oligonucleotide sequences of SEQ ID No.3 and SEQ ID No.4 as Primers, carry out PCR amplification, obtain PCR amplification product as shown in SEQ ID No.1, TPPI The cDNA sequence of the gene is shown in the 32nd to the 1174th nucleotide from the 5' end in SEQ ID No.1, and the TPPI prot...

Embodiment 2

[0042] Embodiment 2, TPPI Effects of Genes on Plant Drought Resistance

[0043] (1) TPPI Obtaining of Gene Overexpression Plants

[0044] The recombinant plasmid pMDC140- obtained in Example 1 TPPI Transformed into C58 Agrobacterium, using the method of Agrobacterium infection to transform pMDC140- TPPI The plasmid was transferred into wild-type Col, and the transfected plants were screened on MS medium containing 30 mg / L hygromycin to obtain homozygous hygromycin-resistant TPPI Transgenic plants with gene overexpression, from which 7 transgenic plants were selected, namely OE1, OE3, OE4, OE5, OE6, OE7 TPPI Detection of gene expression levels.

[0045] transgenic plants TPPI The detection results of gene expression levels are as follows: figure 1 shown. The wild-type Col was used as the control group; the eIF-4A gene was used as the internal reference gene to ensure that the initial amount of cDNA was consistent; the results in the figure showed that, TPPI The gene h...

Embodiment 3

[0049] Embodiment 3, TPPI Detection of Stomatal Opening in Gene Overexpression Plants

[0050] After the transgenic plants OE5 and wild-type Col were grown on MS medium for 3 weeks, the rosette leaves of the plants were cut off, soaked in stomata-opening buffer (10 mM MES-KOH, pH 6.15, 10 mM KCl) for 2 h, and kept under light. The first true leaf was taken for subsequent stomatal opening experiments. After the stomata were completely opened, they were treated with 10 μM ABA for 2 h, and the stomatal opening was observed microscopically. The results were as follows: image 3 shown.

[0051] image 3 It was shown that under the condition of 10 μM ABA treatment, the stomatal opening of the transgenic plant OE5 was inhibited compared with the wild-type Col, but there was no difference between the two under the control condition of 0 μM ABA treatment. illustrate TPPI Genes capable of suppressing stomatal opening in plants.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the field of biotechnology, and specifically relates to TPPI Application of genes in regulating plant stomatal opening and improving plant drought resistance. TPPI The gene sequence is shown in the 32nd to 1138th nucleotides from the 5' end of SEQ ID NO.1. At the same time, it discloses a method for increasing the trehalose content of plants, suppressing the opening of stomata and improving the drought resistance of plants. TPPI by overexpression of genes. The present invention proves that Arabidopsis TPPI Genes play an important role in regulating plant trehalose content, inhibiting stomatal opening and improving plant drought resistance.

Description

technical field [0001] The invention belongs to the field of biotechnology, and specifically relates to TPPI Application of genes in regulating plant stomatal opening and improving plant drought resistance. Background technique [0002] Drought is an important reason affecting crop yield. When the soil is dry, the water loss of the plant is serious, the cells lose tension, the leaves droop, the plant grows difficult or stops growing and temporarily wilts, if the plant cannot get absorbable water, the plant will change from temporary wilting to permanent wilting until the plant dies . Plants have evolved a series of strategies to resist drought stress in order to achieve normal growth and development in complex and changeable environments. Among them is osmoregulation. Specifically, by regulating metabolism-related genes and a series of metabolic pathways, it reduces or repairs the stress damage suffered by plants and maintains a series of physiological activities of plan...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/16C12N15/55C12N15/82A01H5/00A01H5/12A01H6/20
CPCC12N9/16C12N15/8245C12N15/8273C12Y301/03012
Inventor 王凯林清芳王松朱虹
Owner FUJIAN AGRI & FORESTRY UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap