Application of tppi gene in regulating plant stomatal opening and improving plant drought resistance
A transgenic plant, drought-resistant technology, applied in the biological field, can solve problems such as no reports
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Embodiment 1, TPPI cDNA gene cloning
[0034] (1) Design and synthesis of primers
[0035] according to TPPI The CDS sequence of the gene is used to design primers with Gateway adapters, and the primer sequences are:
[0036] SEQ ID No.3: Forward primer
[0037] 5'- GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGTGCGTTTTGTCGTGGAA-3'
[0038]SEQ ID No.4: reverse primer
[0039] 5'- GGGGACCACTTTGTACAAGAAAGCTGGGTCTCACATTCTTGGCTGCATTTGT-3'
[0040] (2) Extract wild-type Arabidopsis, namely Arabidopsis Col-0 ecotype ( Arabidopsis thaliana , Columbiaecotype) (hereinafter referred to as Col) total RNA, obtained Arabidopsis cDNA by reverse transcription, using Arabidopsis cDNA as a template, and the oligonucleotide sequences of SEQ ID No.3 and SEQ ID No.4 as Primers, carry out PCR amplification, obtain PCR amplification product as shown in SEQ ID No.1, TPPI The cDNA sequence of the gene is shown in the 32nd to the 1174th nucleotide from the 5' end in SEQ ID No.1, and the TPPI prot...
Embodiment 2
[0042] Embodiment 2, TPPI Effects of Genes on Plant Drought Resistance
[0043] (1) TPPI Obtaining of Gene Overexpression Plants
[0044] The recombinant plasmid pMDC140- obtained in Example 1 TPPI Transformed into C58 Agrobacterium, using the method of Agrobacterium infection to transform pMDC140- TPPI The plasmid was transferred into wild-type Col, and the transfected plants were screened on MS medium containing 30 mg / L hygromycin to obtain homozygous hygromycin-resistant TPPI Transgenic plants with gene overexpression, from which 7 transgenic plants were selected, namely OE1, OE3, OE4, OE5, OE6, OE7 TPPI Detection of gene expression levels.
[0045] transgenic plants TPPI The detection results of gene expression levels are as follows: figure 1 shown. The wild-type Col was used as the control group; the eIF-4A gene was used as the internal reference gene to ensure that the initial amount of cDNA was consistent; the results in the figure showed that, TPPI The gene h...
Embodiment 3
[0049] Embodiment 3, TPPI Detection of Stomatal Opening in Gene Overexpression Plants
[0050] After the transgenic plants OE5 and wild-type Col were grown on MS medium for 3 weeks, the rosette leaves of the plants were cut off, soaked in stomata-opening buffer (10 mM MES-KOH, pH 6.15, 10 mM KCl) for 2 h, and kept under light. The first true leaf was taken for subsequent stomatal opening experiments. After the stomata were completely opened, they were treated with 10 μM ABA for 2 h, and the stomatal opening was observed microscopically. The results were as follows: image 3 shown.
[0051] image 3 It was shown that under the condition of 10 μM ABA treatment, the stomatal opening of the transgenic plant OE5 was inhibited compared with the wild-type Col, but there was no difference between the two under the control condition of 0 μM ABA treatment. illustrate TPPI Genes capable of suppressing stomatal opening in plants.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com