Supercharge Your Innovation With Domain-Expert AI Agents!

A kind of construction method of monocot miRNA efficient overexpression vector

A technique for monocotyledonous plants and overexpression vectors, which is applied in the direction of recombinant DNA technology, the use of vectors to introduce foreign genetic material, etc., which can solve the problems of insufficient expression of miRNA and unobvious phenotype of expressed plants, and achieve simple and easy operation and connection high efficiency effect

Active Publication Date: 2022-05-06
SHENZHEN UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In order to overcome the problem of insufficient expression of the target miRNA in the traditional plant miRNA overexpression method and the problem that the phenotype of the overexpressed plant is not obvious, the inventors found that the maize Ubi promoter is highly expressed in monocotyledonous plant tissues, while in dicotyledonous plants it is not Weaker, based on this, a method for constructing a high-efficiency monocot miRNA overexpression vector is proposed, which includes the following steps: S1, for the target miRNA, preparing a corresponding linking sequence;

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of construction method of monocot miRNA efficient overexpression vector
  • A kind of construction method of monocot miRNA efficient overexpression vector
  • A kind of construction method of monocot miRNA efficient overexpression vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0029] The present invention is further described below in conjunction with specific embodiment:

[0030] As an example, this example is used for the construction method of the miRNA high-efficiency overexpression vector of monocotyledonous plants, including the following steps:

[0031] (1) Preparation of the carrier

[0032] 1.1. Cloning vector pOT2-polycis-UN: refer to figure 1 In the process shown, the intermediate vector pOT2-polycis-UN required for high-efficiency overexpression of monocotyledonous plants is constructed, and the structure of PacI-Ubi promoter and Nos terminator-MluI is introduced, and the map of successfully constructed pOT2-polycis-UN is as follows figure 2 shown.

[0033] The sequences of the primers required for construction are:

[0034] SmaI-PacI-Ubi-F (TCCCCCGGGTTAATTAAGCATGCCTGCAGTGCAGTGCAGC) (SEQ ID No. 2) / HindIII-Ubi-R (CCCAAGCTTGAACTACCGGGCCCTAACCATGG) (SEQ ID No. 3);

[0035] EcoRI-NOS-F (TCGGATCCCTGCTAGAATTCGATCGTTCAAACATTTGGCAATAAAG) (S...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biotechnology, and discloses a method for constructing a high-efficiency monocot miRNA overexpression vector, comprising the following steps: S1, preparing a linking sequence corresponding to the target miRNA; S2, cloning the linking sequence described in S1 To the cloning vector, to obtain the promoter-junction-terminator structure; S3, the stem-loop structure for overexpressing the target miRNA is introduced into the promoter-junction-terminator structure of S2, so that it has at least Two stem-loop structures; S4, the promoter-junction sequence-terminator structure obtained by S3 is cloned into a binary vector by double enzyme digestion. The invention has high connection efficiency, simple and easy operation, avoids the introduction of unnecessary transgenic components, is beneficial to the research on the function of miRNA in monocotyledonous plants, and is more conducive to the phenotype observation and result interpretation of subsequent transgenic plants.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method for constructing a high-efficiency monocot miRNA overexpression vector, which can be used for the research on the function of the monocot miRNA. Background technique [0002] Plant microRNA (miRNA) is a kind of endogenous small non-coding RNA (small non-coding RNA) with a length of about 20-24 nt, which can combine with Argonaute (AGO) protein to form a RISC complex (RNA-induced silencing complex). Directly cut the mRNA of the target gene or inhibit the translation of the target gene, and indirectly act on the target gene mRNA by cutting a large number of phasiRNAs generated from the transcripts derived from the PHAS site, thereby inhibiting the expression of the target gene, thereby affecting the growth and development of the plant. It mainly includes root formation, stem and leaf development, floral organ formation, fruit development, etc., as well as responses to biotic a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/66
CPCC12N15/66
Inventor 唐贵良杨晓玉李琳罗淋淋刘琳罗光宇
Owner SHENZHEN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More