A kind of anti-tumor protein and its application

A protein, anti-cancer technology, applied in anti-tumor protein and its application field, can solve the problems of difficult protein, huge difficulty in extracting protein, etc.

Active Publication Date: 2020-09-04
JIANGNAN UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Plasmodium mainly invades the body through the binding of proteins carried on the surface or inside of the parasite to receptors on the surface of liver cells or red blood cells. However, it is difficult to efficiently and accurately obtain proteins that respond to tumors due to the difficulty in extracting proteins from Plasmodium merozoites.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of anti-tumor protein and its application
  • A kind of anti-tumor protein and its application
  • A kind of anti-tumor protein and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Construction of embodiment 1PvTrag17 recombinant plasmid

[0022] Prokaryotic expression plasmid pET28a(+), host strain BL21(DE3) and IPTG for induction were purchased from Beijing Quanshijin Biotechnology Co., Ltd.; restriction enzymes, T4 DNA ligase, pfu DNA polymerase and dNTP were purchased from TakaRa Corporation. The synthesis of primers and nucleotide sequence sequencing were completed by Suzhou Jinweizhi Biotechnology Co., Ltd. Agarose affinity medium nickel column (Ni) was purchased from QIAGEN. His-Taq tag antibody was purchased from Cell Signaling Technology Company.

[0023] Design primers to obtain the gene sequence of P. vivax PvTrag17 protein by PCR. The primers are as follows: SEQ ID NO.3: GGATCCATGGAACTAAAAAGCCAATATG; SEQ ID NO.4: CTCGAGTGAGTCATTATCTGTGCTCAC, where GGATCC is the restriction site BamHI of SEQ ID NO.3; CTCGAG is Restriction site XhoI of SEQ ID NO.4.

[0024] Using the Plasmodium ovale genome as a template, the PvTrag17 gene sequence w...

Embodiment 2

[0027] Embodiment 2 Expression of recombinant protein PvTrag17

[0028] Inoculate 5ml of LB medium containing kanamycin with the positive single clone with correct sequencing, culture overnight at 37°C, inoculate the bacterial liquid into 500ml fresh LB medium containing kanamycin, when OD 600 When it is 0.6-0.8, add 1mmol / L IPTG, induce 8h. The induced PvTrag17 was ultrasonically disrupted and lysed, and the 10% SDS-PAGE electrophoresis analysis showed that the PvTrag17 protein was mainly located in the inclusion body, and the molecular weight was consistent with the expectation.

[0029] Dissolve inclusion bodies with 8M urea to release PvTrag17 protein, which has a His-tag tag at the carbon terminus. Therefore, use GE’s His-tag nickel column and carry out Ni 2+ Affinity chromatography purification. The protein was purified with different concentrations of imidazole. The concentrations of imidazole were 20mM, 50mM, 100mM, 150mM and 250mM. The protein washed with 150mM imid...

Embodiment 3

[0031] Example 3 Identification of anti-tumor activity of PvTrag17 protein

[0032] (1) CCK8 method to detect the inhibitory effect of PvTrag17 on the proliferation of tumor cells

[0033] Take HepG2 in the logarithmic phase and use DMEM medium containing 10% FBS to adjust the cell concentration to 5×10 4 / mL, inoculated in 96-well plate with 100 μL per well, placed in 5% CO 2 , cultured in a 37°C incubator for 6 hours, discarded the supernatant after the cells adhered to the wall, washed with PBS buffer to remove non-adhered cells. 100 μL of drugs with different concentrations (10, 50, 100 μg / mL) were added to the sample group, and an equal volume of medium was added to the blank group. After continuing to culture for 24 hours, add 10 μL CCK8 solution to each well, continue to culture in the incubator for 2 hours, and measure the absorbance at 450 nm. A dose of 25 μg / mL antineoplastic drug 5-Fu was used as the control. Cell proliferation rate (%)=experimental group A450 / c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an anti-tumor protein and an application thereof, belonging to the technical field of biomedicine. The invention firstly screens and verifies the application of PvTrag17 protein shown in SEQ ID NO. 1 in anti-tumor field, The results of CCK8 proliferation assay showed that PvTrag17 protein inhibited the proliferation of HepG2 cells by 63.1% and almost completely inhibited the migration of HepG2 cells. The PvTrag17 protein of the invention can be used as an antineoplastic drug of active ingredient or raw material, and has wide application prospect.

Description

technical field [0001] The invention relates to an anti-tumor protein and its application, belonging to the technical field of biomedicine. Background technique [0002] Malaria is the earliest disease that accompanies humans, and it is still one of the most important infectious diseases worldwide. At present, most of the studies on malaria focus on the invasion mechanism of different species of Plasmodium and the development of malaria vaccines, while there are few studies on the medicinal value or potential clinical application value of Plasmodium. There are clinical data showing that after tumor patients are infected with Plasmodium, the tumor growth in the patient is inhibited, revealing the possibility of the application of Plasmodium in clinical tumor treatment. Plasmodium mainly invades the body through the binding of proteins carried on the surface or inside of the parasite to receptors on the surface of liver cells or erythrocytes. However, it is difficult to effic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C07K14/445C12N15/70A61K38/17A61P35/00
CPCA61K38/1767A61P35/00C07K14/445C12N15/70Y02A50/30
Inventor程洋付海田石晓丹玄英花张馨心楚瑞林
OwnerJIANGNAN UNIV