Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

hsa-miR-146a-5p gene PCR detection kit and application thereof

A detection kit and the technology of the kit, which are used in the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve the problems of high cost, lack of effectiveness and coverage of detection methods, etc., to improve the accuracy and improve the sample. The effect of coverage

Inactive Publication Date: 2019-01-18
ZHEJIANG UNIV
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The development of these detection methods has greatly promoted the progress of leukemia-related basic research and clinical drug development, but the effectiveness and coverage of a single detection method are still obviously lacking; using genome sequencing, whole exome sequencing and other methods can achieve overall coverage , the current cost is still relatively high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • hsa-miR-146a-5p gene PCR detection kit and application thereof
  • hsa-miR-146a-5p gene PCR detection kit and application thereof
  • hsa-miR-146a-5p gene PCR detection kit and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1: hsa-miR-146a-5p gene PCR detection kit

[0041] Table 1 Composition of hsa-miR-146a-5p gene detection kit:

[0042]

[0043]

[0044] Wherein, the specific miRNA reverse transcription primer is hsa-miR-146a-5p specific miRNA reverse transcription primer and U6 specific miRNA reverse transcription primer, and the sequences are shown in Table 2.

[0045] Table 2

[0046] name

sequence

hsa-miR-146a-5p

5'–GTGCAGGGTCCGAGGTCAGAGCCACCTGGGCAATTTTTTTTTTTAACCCA-3'

U6

5'–GTGCAGGGTCCGAGGTCAGAGCCACCTGGGCAATTTTTTTTTTTAGTCAG-3'

[0047] Table 3 hsa-miR-146a-5p gene-specific primers (L1, R1) and probe (P1) sequences

[0048] name

sequence

Strand

T m

Purity

Modification

L1

CCGATGTGTATCTCAGCTTT

forward

54.7

gaps

R1

ATCCCAGCTGAAGAACTGAA

reverse

53.4

gaps

P1

AGGTCTGACACTGACACAACCCATGG

reverse

62.6

HPLC

5'Fam-3'Tamra

...

Embodiment 2

[0051] Example 2: Application of hsa-miR-146a-5p gene PCR detection kit

[0052] Using the hsa-miR-146a-5p gene PCR detection kit of Example 1, 61 cases of different drug-resistant subcloned samples of the acute myeloid leukemia cell line OCI-AML3 (purchased from ATCC) were detected by fluorescent RT-PCR Conduct research to determine the optimal cut-off value of hsa-miR-146a-5p in the evaluation of drug resistance analysis of acute myeloid leukemia cells.

[0053] 1. Preparation of subcloned samples with different drug resistance

[0054] OCI-AML3 cells were routinely cultured at 37 degrees 5% CO 2 In the incubator, the normal medium for the cells is RPMI1640 supplemented with 10% fetal bovine serum, the medium is changed every 72 hours, and the seeding density is 0.2×10 6 a / mL;

[0055] Collect OCI-AML3 cells in the logarithmic growth phase, according to 1×10 6 Cells / mL density inoculated in the normal medium containing 1mMAraC (cytarabine) and cultured for 48 hours, then...

Embodiment 3

[0075] Embodiment 3: Reliability test of the optimal critical value of the hsa-miR-146a-5p gene PCR detection kit of the present invention in clinical samples

[0076] 1. Experimental method

[0077] (1) Test samples: According to the National Comprehensive Cancer Network (NCCN) Clinical Practice Guidelines: Acute Myeloid Leukemia Diagnostic Criteria (2015.V1), anticoagulated peripheral blood samples (before treatment) collected from first-diagnosed patients with acute myeloid leukemia 28 Cases (the first consultation time was July-September 2015). According to whether leukemia patients achieved long-term remission within 24 months after receiving treatment, the test samples were divided into two groups: remission group (15 cases) and drug-resistant relapse group (13 cases);

[0078] (2) Extract the total cellular RNA according to the standard instructions provided by the conventional method (QIAamp RNA Blood Mini kit), and store it at -80°C after the Nano drop detects the co...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an hsa-MiR-146a-5p gene PCR detection kit and application thereof, that kit comprise hsa-MiR- 146a-5p gene reverse transcription reaction solution, MMLV reverse transcriptase,RNase inhibitor, PCR reaction solution, Taq enzyme, hsa-MiR-146a-5p gene specific prim, probe, positive control and negative control; Using the hsa-MiR-146a- 5p, that accuracy of drug resistance of leukemia cell line could reach more than 80%, As that agent use in the invention, including enzyme, buffer, primer, probe and the like, are carefully designed and optimized, the accuracy of gene expression detection is greatly improve.

Description

technical field [0001] The invention belongs to the field of life science and biotechnology, in particular to a detection probe and a related detection kit for leukemia cell drug resistance related gene hsa-miR-146a-5p, in particular to a specificity of hsa-miR-146a-5p gene Probe preparation primers, a rapid detection kit for the detection of hsa-miR-146a-5p gene expression, and a rapid assessment method for drug resistance of leukemia cell lines. Background technique [0002] Leukemia is a common hematologic malignancy worldwide, but its etiology has not yet been fully elucidated. The incidence of leukemia in my country ranks sixth in the incidence of various tumors, among which the incidence of acute myeloid leukemia (AML) and acute lymphoblastic leukemia (ALL) is relatively high, and the incidence of chronic myeloid leukemia (chronic myeloid leukemia) is relatively high. CML), while chronic lymphocytic leukemia (chronic lymphocyte leukemia, CLL) is relatively rare in clin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6886C12Q1/6851
CPCC12Q1/6851C12Q1/6886C12Q2600/158C12Q2600/166C12Q2600/178C12Q2521/107C12Q2527/127C12Q2545/101C12Q2545/113
Inventor 陈烨胡晓佳
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com