Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of slglr3 Gene in Improving Plant Botrytis Botrytis Resistance

Botrytis cinerea and genetic technology, applied in the fields of application, plant peptides, plant products, etc., to achieve the effect of improving resistance

Active Publication Date: 2020-06-19
ZHEJIANG UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the field of resistance to plant fungal diseases, the GLR3 gene has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of slglr3 Gene in Improving Plant Botrytis Botrytis Resistance
  • Application of slglr3 Gene in Improving Plant Botrytis Botrytis Resistance
  • Application of slglr3 Gene in Improving Plant Botrytis Botrytis Resistance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1 Preparation and identification of tomato glr3 deletion mutant plants

[0030] 1.1 Construction of CRISPR / Cas9 vector containing specific sgRNA

[0031] Find the full-length DNA sequence of GLR3 on the SGN website https: / / solgenomics.net / as shown in SEQ ID NO.3, and enter its sequence into http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR website, look for the PAM sequence, that is, the sequence of 5'-NGG-3' (N represents any nucleotide of A, T, C, G), define the sequence 20 bp before NGG as sgRNA, and look for specific targeting sgRNA for the protein coding region of the gene. The DNA sequence of the sgRNA specifically targeting the protein coding region of the GLR3 gene is shown in SEQ ID NO.4.

[0032] Design CRISPR primers as follows:

[0033] CRISPR front primer (SEQ ID NO.5): CTGGAGCTACTGTGACGCGA;

[0034] Post-CRISPR primer (SEQ ID NO.6): TCGCGTCACAGTAGCTCCAG;

[0035]The intermediate vector pMD18-T was cleaved with BbsI and purified using a common...

Embodiment 2

[0046] Example 2 In Vitro Identification of Tomato SlGLR3 Gene Disease Resistance Phenotype

[0047] The tomato glr3 deletion mutant leaves were inoculated with Botrytis cinerea, specifically as follows:

[0048] Botrytis cinerea pathogenic bacteria were cultivated using V8 solid medium (36% V8 fruit juice, 0.2% CaCO 3 , 2% agar powder), cultivated for about 15 days at 22°C in the dark, and after the petri dish was covered with spores, it was stored in the dark at 4°C and could be used within a week.

[0049] When in use, put the mycelia block into the inoculation medium (1% peptone, 4% maltose monohydrate), scrape off the mycelium with a tissue culture blade, vortex vigorously to release the spores, filter with gauze, and check the hemocytometer plate under the microscope Adjusted the concentration of spores down to 10 6 spores / ml is the inoculum.

[0050] Spot test on detached leaves: Take 2.5 μl of the inoculation solution with adjusted concentration, put it on the leave...

Embodiment 3

[0052] Example 3 Identification of tomato SlGLR3 gene disease resistance function and its influence on resistance hormone

[0053] The tomato glr3 deletion mutant plants were inoculated with Botrytis cinerea pathogenic bacteria, specifically as follows:

[0054] Botrytis cinerea pathogen culture V8 solid medium (36% V8 fruit juice, 0.2% CaCO 3 , 2% agar powder), cultivated for about 15 days at 22°C in the dark, and after the petri dish was covered with spores, it was stored in the dark at 4°C and could be used within a week.

[0055] When in use, put the mycelia block into the inoculation medium (1% peptone, 4% maltose monohydrate), scrape off the mycelium with a tissue culture blade, vortex vigorously to release the spores, filter with gauze, and check the hemocytometer plate under the microscope Adjusted the concentration of spores down to 10 6 spores / ml is the inoculum.

[0056] Whole plant inoculation test: Pour the adjusted inoculum solution into a 100ml watering can, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of an S1GLR3 gene in improvement of plant gray mold resistance. The nucleotide sequence of a S1GLR3 gene protein coding region is as shown in SEQ ID NO. 1. According to the invention, a CRISPR / Cas9 gene editing technology is used to obtain a tomato glr3 deletion mutant plant, and the technical scheme proves that the application of the SlGLR3 gene in improvementof plant gray mold resistance can be used for selective breeding of gray-mold-resistant tomatoes.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the application of the SlGLR3 gene in improving plant gray mold resistance. Background technique [0002] With the progress of my country's modern agriculture, the vegetable industry has flourished in recent decades, but the high incidence of fungal diseases has greatly affected the growth, yield and quality of horticultural crops. Tomato (Solanum lycopersicum L.) is a worldwide economic crop, and the planting area and output of tomato in my country are among the top in the world. In addition, tomato is also extremely vulnerable to pathogenic bacteria, which has caused great economic losses. [0003] Botrytis cinerea is a necrotrophic fungal disease caused by Botrytis cinerea. Botrytis cinerea can lead to crop yield reduction or even failure in severe cases, which is an important factor that threatens crop safety production in my country and even the world. At present, the control...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29A01H5/00A01H6/82
CPCC07K14/415C12N15/8282
Inventor 喻景权潘蔡哲师恺
Owner ZHEJIANG UNIV