Unlock instant, AI-driven research and patent intelligence for your innovation.

Diagnostic kit for obesity gene mutation and application thereof

A diagnostic kit and obesity technology, which is applied in the fields of life science and biology, can solve the problems of high sequencing cost due to data volume requirements, impossible sequencing depth, large amount of sequencing data, etc., so as to save sequencing data volume and intuitive result interpretation , low cost effect

Inactive Publication Date: 2019-04-16
ZHEJIANG UNIV
View PDF5 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The high cost of sequencing caused by huge data volume requirements has limited the application of whole genome sequencing in the genetic diagnosis of obesity
Whole genome sequencing and whole exome sequencing need to generate a large amount of sequencing data, and the sequencing cost is high, so the sequencing depth cannot be too deep

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Diagnostic kit for obesity gene mutation and application thereof
  • Diagnostic kit for obesity gene mutation and application thereof
  • Diagnostic kit for obesity gene mutation and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Embodiment 1 A kind of diagnostic kit and preparation method of obesity gene mutation of the present invention

[0034] The diagnostic kit provided by the invention is realized through the following preparation steps:

[0035] 1) For the coding sequence of the gene, from the 5' to the 3' direction, according to the principle of sequence reverse complementarity, design a probe sequence with a length of 100bp from the first base, and every two adjacent probe sequences There is an overlap between the needle sequences, and the overlap between each two adjacent probe sequences is 1 / 2 or 2 / 3 of the length of the probe, a total of 535 genes;

[0036] 2) At the 5' end and 3' end of each probe sequence, add CAAGCAGAAGACGGCATACGAGAT and GTGACTGGAGTTCAGACGTG sequences and specific sample recognition sequences respectively to form linker sequences at both ends;

[0037] 3) Using oligonucleotide in-situ synthesis technology, the above-mentioned probe sequence is synthesized on a la...

Embodiment 2

[0040] 1. Preparation of kits for obesity-related pathogenic genes

[0041] According to the human reference genome HG19, combined with Ensembl, CCDS, Gencode, VEGA, SNP and CytoBand databases, all coding sequences of obesity-related pathogenic genes in the following table 1 were obtained; according to figure 1 The schematic diagram shown in the preparation of the obesity-related pathogenic gene DNA probe library:

[0042] The first step, genomic DNA fragmentation

[0043] 1) Transfer the genomic DNA into a 0.6ml microcentrifuge tube according to the above system, mix well, and put it on ice after short centrifugation;

[0044] 2) Turn on the ultrasonic interrupter in advance. After the temperature of the cold cycler drops to 4°C, set the parameters to be turned on for 30s and turned off for 30s as a cycle, and every 10cycles is a round, and a total of 3 rounds are performed. After each round, the sample is placed Mix well on a shaker, and then perform the next round of inter...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a diagnostic kit for obesity gene mutation. Probe sequences are designed according to the principle of sequence reverse complementation in the direction from 5' to 3' specific to the coding sequence of obesity-related pathogenic genes, and the oligonucleotide in situ synthesis technology is adopted on a connecting joint of each probe sequence to conduct large-scale synthesisof oligonucleotide on a chip, the oligonucleotide on the chip is eluted with ammonia water to form an oligonucleotide mixture, and a biotin-labeled primer at 5' end is adopted to form a DNA probe library of biotin-labeled obesity-related pathogenic genes in a PCR method. A high-throughput screening method and application for obesity-related known sites are achieved, are faster, more economical and simpler than detection of single site-specific screening and whole-genome or whole-exon sequencing, have low equipment and environmental requirements, can be used in the polymorphic sites of obesity-related known nuclear genes, and is suitable for large-scale screening and preventive examination of obesity-related people.

Description

technical field [0001] The invention belongs to the field of life science and biotechnology, and in particular relates to a diagnostic kit for obesity gene mutation and the application of the kit in detecting polymorphic sites of nuclear genes related to human obesity. Background technique [0002] Obesity refers to a certain degree of obvious overweight and thick fat layer, which is a state caused by excessive accumulation of body fat, especially triglycerides. It does not refer to simple weight gain, but the state of excess accumulation of fat tissue in the body. Excessive body fat accumulation due to excessive food intake or changes in body metabolism results in excessive weight gain and causes human pathology, physiological changes or latency. Genetic factors are thought to play an important role in the development of obesity. If one of the parents is obese, the child has a 40% chance of being obese. If both parents are obese, the chance of the child being obese increa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883C12N15/11
CPCC12Q1/6883C12Q2600/156
Inventor 傅君芬冀延春王金玲赵宁宁管敏鑫
Owner ZHEJIANG UNIV