Diagnostic kit for obesity gene mutation and application thereof
A diagnostic kit and obesity technology, which is applied in the fields of life science and biology, can solve the problems of high sequencing cost due to data volume requirements, impossible sequencing depth, large amount of sequencing data, etc., so as to save sequencing data volume and intuitive result interpretation , low cost effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Embodiment 1 A kind of diagnostic kit and preparation method of obesity gene mutation of the present invention
[0034] The diagnostic kit provided by the invention is realized through the following preparation steps:
[0035] 1) For the coding sequence of the gene, from the 5' to the 3' direction, according to the principle of sequence reverse complementarity, design a probe sequence with a length of 100bp from the first base, and every two adjacent probe sequences There is an overlap between the needle sequences, and the overlap between each two adjacent probe sequences is 1 / 2 or 2 / 3 of the length of the probe, a total of 535 genes;
[0036] 2) At the 5' end and 3' end of each probe sequence, add CAAGCAGAAGACGGCATACGAGAT and GTGACTGGAGTTCAGACGTG sequences and specific sample recognition sequences respectively to form linker sequences at both ends;
[0037] 3) Using oligonucleotide in-situ synthesis technology, the above-mentioned probe sequence is synthesized on a la...
Embodiment 2
[0040] 1. Preparation of kits for obesity-related pathogenic genes
[0041] According to the human reference genome HG19, combined with Ensembl, CCDS, Gencode, VEGA, SNP and CytoBand databases, all coding sequences of obesity-related pathogenic genes in the following table 1 were obtained; according to figure 1 The schematic diagram shown in the preparation of the obesity-related pathogenic gene DNA probe library:
[0042] The first step, genomic DNA fragmentation
[0043] 1) Transfer the genomic DNA into a 0.6ml microcentrifuge tube according to the above system, mix well, and put it on ice after short centrifugation;
[0044] 2) Turn on the ultrasonic interrupter in advance. After the temperature of the cold cycler drops to 4°C, set the parameters to be turned on for 30s and turned off for 30s as a cycle, and every 10cycles is a round, and a total of 3 rounds are performed. After each round, the sample is placed Mix well on a shaker, and then perform the next round of inter...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



