Building method and application of deafness related gene library
A construction method and gene library technology, applied in chemical libraries, combinatorial chemistry, library creation, etc., can solve the problems of high sequencing cost due to data volume, impossibility of too deep sequencing depth, large amount of sequencing data, etc., so as to save sequencing The effect of data volume, intuitive interpretation of results, and low cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Embodiment 1 A kind of construction method of deafness-related gene library
[0033] The present invention is mainly composed of 6 components including an A-tailed system, a joint connection system, a purification system, a pre-PCR reaction system, a probe hybridization system, and a post-PCR reaction system after the whole genome DNA is interrupted:
[0034] 1) For the coding sequence of the gene, from the 5' to the 3' direction, according to the principle of sequence reverse complementarity, design a probe sequence with a length of 90bp from the first base, and every two adjacent probe sequences There are overlaps between needle sequences, a total of 246 genes;
[0035] 2) At the 5' end and 3' end of each probe sequence, add CAAGCAGAAGACGGCATACGAGAT and GTGACTGGAGTTCAGACGTG sequences and specific sample recognition sequences respectively to form linker sequences at both ends;
[0036] 3) Using oligonucleotide in-situ synthesis technology, the above-mentioned probe se...
Embodiment 2
[0039] 1. Preparation of kits for deafness-related pathogenic genes
[0040] According to the human reference genome HG19, combined with Ensembl, CCDS, Gencode, VEGA, SNP and CytoBand databases, all coding sequences of deafness-related pathogenic genes in the following table 1 were obtained; according to figure 1 The deafness-related pathogenic gene DNA probe library prepared according to the schematic diagram:
[0041] The first step, genomic DNA fragmentation
[0042] (1) Transfer the genomic DNA to a 0.6ml microcentrifuge tube according to the above system, mix well, and put it on ice after short centrifugation;
[0043](2) Turn on the ultrasonic interrupter in advance. After the temperature of the cold cycler drops to 4°C, set the parameters to turn on for 30s and turn off for 30s as a cycle, and every 10cycles is a round, and a total of 3 rounds are performed. After each round, the sample Put it on a shaker and mix well, and then perform the next round of interruption a...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap