Unlock instant, AI-driven research and patent intelligence for your innovation.

Building method and application of deafness related gene library

A construction method and gene library technology, applied in chemical libraries, combinatorial chemistry, library creation, etc., can solve the problems of high sequencing cost due to data volume, impossibility of too deep sequencing depth, large amount of sequencing data, etc., so as to save sequencing The effect of data volume, intuitive interpretation of results, and low cost

Inactive Publication Date: 2019-05-17
ZHEJIANG UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The high sequencing cost due to the huge data volume requirements has limited the application of whole genome sequencing in the genetic diagnosis of deafness
Whole genome sequencing and whole exome sequencing need to generate a large amount of sequencing data, and the sequencing cost is high, so the sequencing depth cannot be too deep

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Building method and application of deafness related gene library
  • Building method and application of deafness related gene library
  • Building method and application of deafness related gene library

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Embodiment 1 A kind of construction method of deafness-related gene library

[0033] The present invention is mainly composed of 6 components including an A-tailed system, a joint connection system, a purification system, a pre-PCR reaction system, a probe hybridization system, and a post-PCR reaction system after the whole genome DNA is interrupted:

[0034] 1) For the coding sequence of the gene, from the 5' to the 3' direction, according to the principle of sequence reverse complementarity, design a probe sequence with a length of 90bp from the first base, and every two adjacent probe sequences There are overlaps between needle sequences, a total of 246 genes;

[0035] 2) At the 5' end and 3' end of each probe sequence, add CAAGCAGAAGACGGCATACGAGAT and GTGACTGGAGTTCAGACGTG sequences and specific sample recognition sequences respectively to form linker sequences at both ends;

[0036] 3) Using oligonucleotide in-situ synthesis technology, the above-mentioned probe se...

Embodiment 2

[0039] 1. Preparation of kits for deafness-related pathogenic genes

[0040] According to the human reference genome HG19, combined with Ensembl, CCDS, Gencode, VEGA, SNP and CytoBand databases, all coding sequences of deafness-related pathogenic genes in the following table 1 were obtained; according to figure 1 The deafness-related pathogenic gene DNA probe library prepared according to the schematic diagram:

[0041] The first step, genomic DNA fragmentation

[0042] (1) Transfer the genomic DNA to a 0.6ml microcentrifuge tube according to the above system, mix well, and put it on ice after short centrifugation;

[0043](2) Turn on the ultrasonic interrupter in advance. After the temperature of the cold cycler drops to 4°C, set the parameters to turn on for 30s and turn off for 30s as a cycle, and every 10cycles is a round, and a total of 3 rounds are performed. After each round, the sample Put it on a shaker and mix well, and then perform the next round of interruption a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a building method of a deafness related gene library. The building method comprises the steps that aiming at each coding sequence of deafness related disease-causing gene, probesequence is designed according to a sequence reverse complement principle from 5' to 3' direction, an oligonucleotides in situ synthesis technique is adopted at the connection joint of each probe sequence to conduct large-scale synthesis of oligonucleotides on a chip; oligonucleotides on the chip is eluted by using ammonium hydroxide to form an oligonucleotides mixture; and a primer with the 5' end being provided with biotin labels is adopted to form a deafness related disease-causing gene DNA probe library with biotin labels through the PCR method. The deafness related gene library achieveshigh throughput screening of known loci related to deafness, is rapider, more economical, easier and more convenient compared with the method that locus screening and whole genome or whole exon sequencing is conducted independently, has lower requirement on equipment and environment, is beneficial to popularization and application, and is applicable to screening of deafness related groups and preventive checking. The deafness related gene library can be applied to detection of SNP locus of mitochondria DNA.

Description

technical field [0001] The invention belongs to the field of life science and biotechnology, and relates to a method for constructing a deafness-related gene library and the application of the method to comprehensively detect SNP sites of mitochondrial DNA. Background technique [0002] Deafness is a common disease that causes speech communication barriers, seriously affecting people's physical and mental health and quality of life. According to the second sample survey of disabled persons in 2006, there are about 27.8 million people with hearing and speech disabilities in my country, of which 800,000 are deaf-mute children under the age of 7, and there is 1 deaf child in every 700-1000 newborns. Deafness can be divided into non-syndromic deafness and syndromic deafness, of which about 70% of patients are non-syndromic deafness, that is, only the clinical symptoms of a single hearing impairment; and syndromic deafness, in addition to hearing impairment, often Accompanied by...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C40B50/06
Inventor 管敏鑫蒋萍萍冀延春郑静
Owner ZHEJIANG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More