Lactobacillus paracasei and application thereof

A technology of lactobacillus and by-cheese, applied in the field of microorganisms and microbial fermentation, can solve the problem of low 2,3-butanedione content, achieve the effect of enhancing milk flavor and improving market competitiveness

Active Publication Date: 2019-04-19
JIANGNAN UNIV
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] It is currently known that the main substances affecting the flavor of sour cream are 2,3-butanedione, acetic acid and butyric acid, among which 2,3-butanedione is the main contributor to the milk flavor; and 32 The content of 2,3-butanedione in three kinds of commercially available sour cream, the measured results show that the general content of 2,3-butanedione is between 0.45 and

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lactobacillus paracasei and application thereof
  • Lactobacillus paracasei and application thereof
  • Lactobacillus paracasei and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0066] Example 1: Screening of strains of the invention

[0067] (1) Obtain a suitable dilution gradient and cultivate

[0068] Weigh 0.5mL from the traditional fermentation Tula sample of Aba Autonomous Prefecture in Sichuan, add it to 4.5mL sterile water, and then dilute 0.5mL bacterial liquid in 4.5mL sterile water to make the concentration of the sample diluted to 10 -4 , Take 50 μL of 4 bacterial suspensions with dilutions of 10 to 104, respectively, and spread them on the MRS solid medium, and incubate at 37°C for 46 to 48 hours.

[0069] (2) Separation and purification

[0070] Using the plate streak method, select a typical single colony, and repeat this culture selection operation to obtain strains with excellent traits. This operation obtains a total of three strains, namely the strain CGMCC No.14023, the strain 15M9 and the strain 5G2.

[0071] (3) Gram stain and catalase experiment

[0072] Pick single colonies of the above-mentioned strains and do Gram staining and catalase ...

Example Embodiment

[0073] Example 2: Identification of the strain of the invention

[0074] (1) PCR amplification of 16S rDNA

[0075] Aspirate the liquid medium after shaking and mixing in a 1mL glycerol tube, discard the supernatant after centrifugation, and wash twice with 1mL sterile water, then discard the supernatant by centrifugation, and use it as a template for colony PCR.

[0076] a) PCR system 50μL, of which Mix is ​​25μL, 27F is 1μL, 1492R is 1μL, and ddH2O is 23μL.

[0077] The primers used were 27F: AGAGTTTGATCCTGGCCTCA with the sequence shown in SEQ ID NO. 2 and 1492R: GGTTACCTTGTTACGACTT with the sequence shown in SEQ ID NO. 3, and the amplified fragment length was 1500 bp.

[0078] b) PCR conditions:

[0079] Lid: 105℃mBY-16s V: 20μL

[0080] DNA double-strands were denatured at 94°C for 10 minutes, and then cooled at 94°C for 30 seconds to 50°C for 30 seconds. The temperature was rapidly increased to 72°C for 80 seconds and cycled 29 times, and finally kept at 72°C for 7 minutes.

[0081] (...

Example Embodiment

[0086] Example 3: Application of the strain of the invention

[0087] Inoculate Lactobacillus paracasei 15M9, Lactobacillus paracasei 5G2, and Lactobacillus paracasei CGMCCNo.14023 stored at -80°C into MRS liquid medium, culture at 37°C for 24h, subculture 2-3 times, and collect the bacteria 80μL of liquid was inoculated in a headspace phase flask (2mL 20% fat cream), incubated at 20°C for 24h for fermentation, during which, samples were taken every 6h, and the fermented product samples were subjected to 2,3-butanedione Content, sensory evaluation, pH and titratable acidity test (the content test results of 2,3-butanedione are shown in Table 1, and the pH test results are shown in Table 2. figure 1 , The titratable acidity test results are shown in Table 3. figure 2 , See the sensory evaluation results image 3 ).

[0088] It can be seen from Table 1 that the 2,3-butanedione output produced by Lactobacillus paracasei CGMCC No.14023 in each fermentation time period is higher than 1...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a lactobacillus paracasei and an application thereof, which belong to the technical fields of microbe and a microbial fermentation technology. According to the invention, a strain of Lactobacillus paracasei is separated and screened from a dairy product of yak, the Lactobacillus paracasei has a strong ability to produce 2,3-butanedione, after 24h of fermentation, the yieldof 2,3-butanedione can be as high as 759 [mu]g/kg; and the application of Lactobacillus paracasei to the preparation of sour cream can significantly enhance the milk flavor of the sour cream and improve the market competitiveness of sour cream.

Description

technical field [0001] The invention relates to a strain of Lactobacillus paracasei and an application thereof, belonging to the technical field of microorganisms and microbial fermentation. Background technique [0002] Sour cream refers to a kind of dairy product made from cream, which is fermented by pure lactic acid bacteria starter and further processed. It has a bright surface, uniform texture, unique sour flavor, and rich nutrition. It can be eaten directly. It is also an ideal ingredient for western food, and has a broad market among consumers of all ages. [0003] Studies have shown that the main factors affecting consumers to buy sour cream are flavor, price, usability and brand in turn, while Shepard et al. (L.shepard, R.E.miracle, et al. ].Journal of dairy science, 2013,96(9):5435-5454.) found through research that the milk flavor in sour cream is preferred by consumers. [0004] It is currently known that the main substances affecting the flavor of sour cream ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N1/20A23C13/16A61K35/747A61P1/00C12R1/225
CPCA61P1/00A23C13/16A61K2035/115C12R2001/225C12N1/205A23V2400/165
Inventor 陈卫刘小鸣姜杨王岩范大明赵建新张灏
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap