Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primers, probe and detecting method for detecting giardia lamblia through RAA fluorescence method

A Giardia and fluorescence method is applied in the RAA fluorescence method to detect primers, probes and detection fields of Giardia lamblia, which can solve the problems of long time, inconvenient operation and large errors, and achieve the detection method The effect of rapidity, reduced inspection cost, and short inspection time

Pending Publication Date: 2019-05-10
JIANGSU INST OF PARASITIC DISEASES +1
View PDF8 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The main steps of this method are filtration, elution, concentration, separation and purification, fluorescence color development and microscopic examination. The main disadvantage of this method is that the volume of water sample required is large, and the operation is very complicated, with many steps and high operation requirements. The errors in microscopic examination are also relatively large, and it is easy to miss detection and cause false negatives. The effect of species determination and traceability is not ideal. It takes 2-3 days to complete the entire detection
In addition, the cost of testing per sample is high if this method is used
[0005] In view of the shortcomings of the existing detection technology such as long time, inconvenient operation, and high false negatives, a RAA fluorescence method for detecting Giardia lamblia primers, probes and detection methods is provided to make it fast, sensitive, easy to operate, and applicable Rapid detection in the laboratory and on-site is an urgent problem to be solved by those skilled in the art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primers, probe and detecting method for detecting giardia lamblia through RAA fluorescence method
  • Primers, probe and detecting method for detecting giardia lamblia through RAA fluorescence method
  • Primers, probe and detecting method for detecting giardia lamblia through RAA fluorescence method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Embodiment 1 selects the conserved sequence of Giardia lamblia β-giardin gene to carry out primer and probe design

[0037] According to the gene name Giardia lamblia β-giardin gene, find the corresponding whole gene sequence in genebank (www.ncbi.nlm.nih.gov), use DNASTAR software for homology analysis and b1ast sequence analysis, and screen out The highly conserved sequence of the β-giardin gene of Giardia lamblia is as follows:

[0038] GCAAACTTCCGCAAGTCCCTTGCGGAGATGGGCGACACACTCAACAACGTTGAGACAAATCTCCAGAACCAGATCGCCATCCATAACGACGCCATCGCGGCTCTCAGGAAGGAGGCCCTCAAGAGCCTGAACGATCTCGAGACGGGCATTGCCACGGAGAACGCAGAAAGGAAGAAGATGTACGACCAGCTCAACGAGAAGGTCGCAGAGGGCTTCGCCCGCATCTCCGCCGCGATCGAGAAGGAGACGATCGCCCGCGAGAGGGCCGTTAGCGCTGCCACGACAGAAGCGCTCACAAACACGAAGCTCGTCGAG;SEQ ID NO.1;

[0039] Use the highly conserved sequence as the target gene for detection, synthesize positive plasmids and design primers and probes;

[0040] According to the above conserved sequence of the β-giardin gene of...

Embodiment 2

[0078] A kind of RAA fluorescence method detects the method for Giardia lamblia, comprising the steps:

[0079] (1) The samples to be tested are Giardia lamblia cysts or trophozoites, and the nucleic acid is extracted by lysing, magnetic bead enrichment, washing, and elution; store at -20°C for later use;

[0080] (2) Turn on the constant temperature fluorescent gene detector RAA-F1620 to preheat, and set the reaction parameters. The reaction parameters are set to 39° C., and the reaction time is 15 minutes.

[0081] (3) Add 2 μL of primers and 0.5 μL of probes at a concentration of 10 μM to 42.5 μL of reaction buffer, mix well, add to RAA fluorescent basic reaction reagent and mix to obtain a reaction premix;

[0082] (4) Fully mix 5 μL of the nucleic acid extraction solution obtained in the step (1) with the reaction premix solution obtained in the step (3), and put the obtained reaction system into a constant temperature fluorescent gene detector RAA-F1620 to detect the flu...

Embodiment 3

[0084] Embodiment 3 Sensitivity experiment

[0085] (1) The primers, probes and negative quality controls are the same as in Example 1.

[0086] (2) Preparation of working standards:

[0087] Transfer 5 μL of the plasmid to Escherichia coli, cultivate and extract it at a concentration of 10 10 Copies / μL, the plasmids were made into working standards of different gradients, respectively:

[0088] Working Standard 1, containing 1.0 × 10 6 Copies / μL DNA fragment of target gene of Giardia lamblia.

[0089] Working Standard 2, containing 1.0 × 10 5 Copies / μL DNA fragment of target gene of Giardia lamblia.

[0090] Working Standard 3, containing 1.0 × 10 4 Copies / μL DNA fragment of target gene of Giardia lamblia.

[0091] Working Standard 4, containing 1.0 × 10 3 Copies / μL DNA fragment of target gene of Giardia lamblia.

[0092] Working Standard 5, containing 1.0 × 10 2 Copies / μL DNA fragment of target gene of Giardia lamblia.

[0093] (3) Specific implementation steps of...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses primers, probe and detecting method for detecting giardia lamblia through an RAA fluorescence method. The primes, probe and detecting method have high specificity, sensitivityand repeatability, the giardia lamblia can be conveniently, rapidly and accurately authenticated, operation is simple and convenient, the detection time is short, and detection can be completed within15 min. The high flux can be rapidly and easily realized through the detecting method, the detection cost is greatly reduced, sensitivity is high, and the sensitivity of each time of reaction detection reaches 100 Copies per reaction.

Description

technical field [0001] The invention relates to the technical field of molecular biology detection, and more specifically relates to a primer, a probe and a detection method for detecting Giardia lamblia by RAA fluorescence method. Background technique [0002] Giardia lamblia is an apicomplexan parasite that mainly parasitizes the small intestine of humans and some mammals. People of any age can be infected, and children, the elderly, the frail and immunocompromised are especially susceptible to infection. Giardia lamblia forms cysts after reproduction and is excreted with feces. People or animals are infected by ingesting drinking water or food contaminated by live cysts, causing diarrhea and indigestion as the main symptoms of Giardia lamblia Giardiasis. Giardia lamblia exists in water in the form of cysts, with a size of about 8-10 μm. Cysts can remain infective for 2 weeks in water at 25°C, and up to 11 weeks in water at 4°C. The pathogenic dose of Giardia lamblia to ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6893C12Q1/6844C12Q1/04C12N15/11C12R1/90
Inventor 戴洋倪碧娴曹俊王晓婷羊海涛郭利川刘燕红王智宏应清界
Owner JIANGSU INST OF PARASITIC DISEASES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com