Primers, probe and detecting method for detecting giardia lamblia through RAA fluorescence method
A Giardia and fluorescence method is applied in the RAA fluorescence method to detect primers, probes and detection fields of Giardia lamblia, which can solve the problems of long time, inconvenient operation and large errors, and achieve the detection method The effect of rapidity, reduced inspection cost, and short inspection time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Embodiment 1 selects the conserved sequence of Giardia lamblia β-giardin gene to carry out primer and probe design
[0037] According to the gene name Giardia lamblia β-giardin gene, find the corresponding whole gene sequence in genebank (www.ncbi.nlm.nih.gov), use DNASTAR software for homology analysis and b1ast sequence analysis, and screen out The highly conserved sequence of the β-giardin gene of Giardia lamblia is as follows:
[0038] GCAAACTTCCGCAAGTCCCTTGCGGAGATGGGCGACACACTCAACAACGTTGAGACAAATCTCCAGAACCAGATCGCCATCCATAACGACGCCATCGCGGCTCTCAGGAAGGAGGCCCTCAAGAGCCTGAACGATCTCGAGACGGGCATTGCCACGGAGAACGCAGAAAGGAAGAAGATGTACGACCAGCTCAACGAGAAGGTCGCAGAGGGCTTCGCCCGCATCTCCGCCGCGATCGAGAAGGAGACGATCGCCCGCGAGAGGGCCGTTAGCGCTGCCACGACAGAAGCGCTCACAAACACGAAGCTCGTCGAG;SEQ ID NO.1;
[0039] Use the highly conserved sequence as the target gene for detection, synthesize positive plasmids and design primers and probes;
[0040] According to the above conserved sequence of the β-giardin gene of...
Embodiment 2
[0078] A kind of RAA fluorescence method detects the method for Giardia lamblia, comprising the steps:
[0079] (1) The samples to be tested are Giardia lamblia cysts or trophozoites, and the nucleic acid is extracted by lysing, magnetic bead enrichment, washing, and elution; store at -20°C for later use;
[0080] (2) Turn on the constant temperature fluorescent gene detector RAA-F1620 to preheat, and set the reaction parameters. The reaction parameters are set to 39° C., and the reaction time is 15 minutes.
[0081] (3) Add 2 μL of primers and 0.5 μL of probes at a concentration of 10 μM to 42.5 μL of reaction buffer, mix well, add to RAA fluorescent basic reaction reagent and mix to obtain a reaction premix;
[0082] (4) Fully mix 5 μL of the nucleic acid extraction solution obtained in the step (1) with the reaction premix solution obtained in the step (3), and put the obtained reaction system into a constant temperature fluorescent gene detector RAA-F1620 to detect the flu...
Embodiment 3
[0084] Embodiment 3 Sensitivity experiment
[0085] (1) The primers, probes and negative quality controls are the same as in Example 1.
[0086] (2) Preparation of working standards:
[0087] Transfer 5 μL of the plasmid to Escherichia coli, cultivate and extract it at a concentration of 10 10 Copies / μL, the plasmids were made into working standards of different gradients, respectively:
[0088] Working Standard 1, containing 1.0 × 10 6 Copies / μL DNA fragment of target gene of Giardia lamblia.
[0089] Working Standard 2, containing 1.0 × 10 5 Copies / μL DNA fragment of target gene of Giardia lamblia.
[0090] Working Standard 3, containing 1.0 × 10 4 Copies / μL DNA fragment of target gene of Giardia lamblia.
[0091] Working Standard 4, containing 1.0 × 10 3 Copies / μL DNA fragment of target gene of Giardia lamblia.
[0092] Working Standard 5, containing 1.0 × 10 2 Copies / μL DNA fragment of target gene of Giardia lamblia.
[0093] (3) Specific implementation steps of...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



