Check patentability & draft patents in minutes with Patsnap Eureka AI!

Application of miR-218 in preparing breast cancer chemotherapeutic drug sensitizer

A kind of mir-218, 1. The technology of mir-218 is applied in the application field of preparing breast cancer chemotherapeutic drug sensitizers, which can solve the problems of unsatisfactory sensitization effect and few types, and achieve inhibition of proliferation and invasion ability, increase The effect of sensitivity

Active Publication Date: 2019-05-14
NANJING MEDICAL UNIV
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

After breast cancer surgery, chemotherapy is often used. In order to enhance the effect of chemotherapy, chemotherapy sensitizers are usually used. However, there are few types of chemotherapy sensitizers at present, and the overall sensitization effect is not ideal.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of miR-218 in preparing breast cancer chemotherapeutic drug sensitizer
  • Application of miR-218 in preparing breast cancer chemotherapeutic drug sensitizer
  • Application of miR-218 in preparing breast cancer chemotherapeutic drug sensitizer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] 1. Cell culture

[0024] Breast cancer cell lines MCF-7, MDA-MB-231, and SUM1315 were purchased from the Cell Resource Center, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. The three breast cancer cell lines were all cultured in Dulbecco's medium containing 10% (V / V) fetal bovine serum (FBS), supplemented with 100 U / mL penicillin and 100 μg / mL streptomycin, and all cells were placed in a medium containing 5 %CO 2 In a 37°C incubator, subculture every 2 to 3 days.

[0025] 2. Extraction and purification of microRNA in breast cancer cells and tissues

[0026] A total of 123 cases were included in this study, all of whom were diagnosed with breast cancer and underwent surgery in the First Affiliated Hospital of Nanjing Medical University from 2014 to 2017. We collected 123 breast cancer tissues and 35 adjacent normal tissues. Use Trizol reagent to extract total RNA from breast cancer cells and breast cancer clinical samples, using mirVana T...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an application of miR-218 in preparing a breast cancer chemotherapeutic drug sensitizer, and belongs to the technical field of molecular drugs of breast cancer. According to theapplication of miR-218 in preparing the breast cancer chemotherapeutic drug sensitizer, miR-218 can obviously increase the sensitivity of breast cancer cells to paclitaxel and doxorubicin; in addition, miR218 can target down-regulate the expression of a DAAM1 gene, and inhibit the proliferation and invasion capacity of breast cancer cells by target down-regulating the expression of the DAAM1 gene. Therefore, a nucleic acid sequence is used as a novel small nucleic acid anti-tumor medicament, so that the sensitivity of breast cancer to chemotherapy medicaments can be enhanced, the proliferation and invasion of tumors can be inhibited, and the nucleic acid sequence has a good application prospect.

Description

technical field [0001] The invention belongs to the molecular medicine technical field of breast cancer, and in particular relates to the application of miR-218 in preparing breast cancer chemotherapeutic drug sensitizers. Background technique [0002] microRNA (miRNA) is a class of endogenous non-coding short-chain RNA fragments, generally 17-23 nucleotides in length. There are about 1,000 miRNAs in the human genome, accounting for 2% of the total number of genes, but they can regulate more than 30% of the genes in the human body. In recent years, the relationship between miRNA and tumor has become a hotspot in the basic research of oncology at the present stage. miRNA can be used as a marker for tumor diagnosis, treatment and prognosis. [0003] miR-218 is a microRNA that exists in the human body. It is located at 12p13.1 of the human chromosome and contains 21 nucleotides. Its sequence is "UUGUGCUUGAUCUAACCAUGU". miR-218 has a similar formation mechanism to other miRNAs...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K31/7105A61K31/337A61K31/704A61P35/00
Inventor 梅杰朱一超严婷张永杰徐步捷
Owner NANJING MEDICAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More