Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Preparation method and application of RNA interference sequence of trehalase gene of Acyrthosiphon pisum

A technology of RNA interference and trehalase, applied in the field of RNA interference sequence preparation

Active Publication Date: 2019-06-07
GANSU AGRI UNIV
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The application of RNAi technology in pests is still in its infancy, and there are many challenges, such as how to enter the insect body and rapidly degrade in the insect body.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and application of RNA interference sequence of trehalase gene of Acyrthosiphon pisum
  • Preparation method and application of RNA interference sequence of trehalase gene of Acyrthosiphon pisum
  • Preparation method and application of RNA interference sequence of trehalase gene of Acyrthosiphon pisum

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1: Preparation and application detection of an RNA interference sequence of the pea aphid trehalase gene

[0032] Experimental steps:

[0033] 1 dsRNA design and synthesis

[0034] According to the sequences submitted by 3 major international databases NCBI, trehalase (XM_003245847.3) was compared with MEGA software to deduce the conserved region, and the software Primer 5.0 was used to design specific amplification primers to amplify pea aphid trehalose synthase and seaweed Carbohydrase Conserved Region Gene. Send the amplified product to Xi'an Qingke for sequencing, and compare the gene sequencing results. The primer sequence is as follows: sense strand 5'-3'GGCGTGGTTTGACTGGGATA

[0035] Antisense strand 5'-3'CAACCAAAACCTGTCTGCGG

[0036] 2. Effects of feeding dsRNA on the mortality rate, gene silencing level, life table parameters, feeding behavior and trehalase activity of two color types of pea aphids

[0037] The concentration of the synthesized dsRNA ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method of an RNA interference sequence of a trehalase gene of Acyrthosiphon pisum. The method comprises the following steps: 1. selecting a target region of RNAiaccording to a trehalase sequence of the Acyrthosiphon pisum (XM_003245847.3), and using Primer5.0 to design a PCR amplification primer in the target region; 2. extracting the total RNA of the Acyrthosiphon pisum and obtaining a cDNA by reverse transcription, and then conducting PCR-amplification on the trehalase gene contained in the cDNA by using the amplification primer to obtain the target gene; and 3. amplifying a double-stranded DNA of interest containing a T7promoter sequence, and then synthesizing a double-stranded RNA using the kit.

Description

technical field [0001] The application belongs to the field of pest control, and specifically relates to a preparation method and application of an RNA interference sequence of a pea aphid trehalase gene. Background technique [0002] The pea aphid (Acyrthosiphon pisum) belongs to the family Aphididae in the order Homoptera. It is widely distributed all over the world and is one of the main pests of many leguminous crops and pastures. In the alfalfa growing areas in Northwest my country, the pea aphid can cause economic losses of 10% to 30% of alfalfa production each year. When the pea aphid harms plants, it uses the piercing-sucking mouthparts to suck the phloem juice of the plant, thereby affecting the growth and development of the plant, normal life activities such as flowering and fruiting, and causing the death of the entire plant when the damage is serious. The pea aphid can be a carrier of plant viruses, and can transmit 25 kinds of viruses such as alfalfa mosaic vir...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/10A01N57/16A01P7/04
CPCY02A50/30
Inventor 王广张克信张艳蕾刘长仲
Owner GANSU AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com