Preparation method and application of RNA interference sequence of trehalase gene of Acyrthosiphon pisum
A technology of RNA interference and trehalase, applied in the field of RNA interference sequence preparation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1: Preparation and application detection of an RNA interference sequence of the pea aphid trehalase gene
[0032] Experimental steps:
[0033] 1 dsRNA design and synthesis
[0034] According to the sequences submitted by 3 major international databases NCBI, trehalase (XM_003245847.3) was compared with MEGA software to deduce the conserved region, and the software Primer 5.0 was used to design specific amplification primers to amplify pea aphid trehalose synthase and seaweed Carbohydrase Conserved Region Gene. Send the amplified product to Xi'an Qingke for sequencing, and compare the gene sequencing results. The primer sequence is as follows: sense strand 5'-3'GGCGTGGTTTGACTGGGATA
[0035] Antisense strand 5'-3'CAACCAAAACCTGTCTGCGG
[0036] 2. Effects of feeding dsRNA on the mortality rate, gene silencing level, life table parameters, feeding behavior and trehalase activity of two color types of pea aphids
[0037] The concentration of the synthesized dsRNA ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap