Escherichia coli for producing tyrosine by fermentation method and its construction method and application

A technology of Escherichia coli and tyrosine, applied in the biological field, can solve problems such as affecting industrial application and genetic instability of engineering strains

Active Publication Date: 2022-05-10
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the engineering strains of E. coli constructed in the above studies can produce high concentrations of tyrosine, the related engineering strains either contain recombinant plasmids that cause genetic instability, or require the addition of organic nitrogen sources or aromatic amino acids and their derivatives to the medium. To promote cell growth, thereby affecting industrial applications

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Escherichia coli for producing tyrosine by fermentation method and its construction method and application
  • Escherichia coli for producing tyrosine by fermentation method and its construction method and application
  • Escherichia coli for producing tyrosine by fermentation method and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Embodiment 1, the construction of Escherichia coli genetic engineering bacterium WJ004

[0053] Escherichia coli genetically engineered strain WJ004 was constructed by weakening the expression regulation of the 3-dehydrogenase shikimate dehydrogenase gene (aroE), through two homologous recombination methods, inserting synthesis regulation upstream of the aroE start codon Element P1 (see Sequence 1 in the Sequence Listing), and replace the original start codon ATG with the rare start codon TTG. The specific construction steps are as follows:

[0054] With the plasmid pEASY-cat-sacB ( figure 2 ) as a template, using primers aroE1-up / aroE1-down to amplify the fragment aroE1 of the first step of homologous recombination. The primer sequences are:

[0055] aroE1-up: GATGCCCTGACGGGTGAACTGTTTCGACAGGGGTAACATA GTGACGGAAGATCACTTC

[0056] aroE1-down: CTGTGGGCTATCGGATTACCAAAAACAGCATAGGTTTCCA ATCAAAGGGAAAACTGTCC

[0057] Amplification system: 5×TransStart TM FastPfu Buf...

Embodiment 2

[0069] Embodiment 2, the construction of Escherichia coli genetic engineering bacterium WJ006

[0070] The Escherichia coli genetically engineered strain WJ006 was constructed on the basis of Escherichia coli WJ004 through the mutation and expression regulation of the 3-deoxy-D-arabinoheptulose-7-phosphate synthase gene (aroF), which was obtained through two homologous recombination The method is to replace the original aroF gene (see sequence 6 in the sequence listing) with the mutated gene aroF* (see sequence 5 in the sequence listing) at the 443rd base C changed to T, to release the 3- Tyrosine feedback inhibition of deoxy-D-arabinoheptulose-7-phosphate synthase, and insertion of synthesis regulatory element P2 upstream of the start codon (see sequence 2 in the sequence listing). The specific construction steps are as follows:

[0071] Using Escherichia coli DSM 1576 genomic DNA as a template, the aroF gene was amplified using primers aroF-F / aroF-R. The primer sequences a...

Embodiment 3

[0108] Embodiment 3, the construction of Escherichia coli genetic engineering bacterium WJ012

[0109] The Escherichia coli genetically engineered strain WJ012 was constructed on the basis of Escherichia coli WJ006 by regulating the expression of the transketolase gene (tktA). It inserted the synthesis regulation upstream of the tktA start codon through two homologous recombination methods. Element P4 (see Sequence 4 in the Sequence Listing). The specific construction steps are as follows:

[0110] With the plasmid pEASY-cat-sacB ( figure 2 ) as a template, using primers tktA1-up / tktA1-down to amplify the fragment tktA1 of the first step of homologous recombination. The primer sequences are:

[0111] tktA1-up: GCCCAAAACGCGCTGTCGTCAAGTCGTTAAGGGCGTGCCCTTCATCAT GTGACGGAAGATCACTTC

[0112] tktA1-down: CATGCTCAGCGCACGAATAGCATTGGCAAGCTCTTTACGTGAGGACAT ATCAAAGGGAAAACTGTCC

[0113] The amplification system and conditions are as described in Example 1. The amplified tktA1 pr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The method discloses a tyrosine-producing Escherichia coli genetically engineered bacterium, its construction method and application. It regulates the 3-dehydroshikimate dehydrogenase AroE in 3-dehydroshikimate (DHS)-producing Escherichia coli, and regulates the prephenate dehydrogenase gene TyrA, anthranilate synthase TrpE and prephenate dehydrogenase gene TyrA by site-directed mutagenesis. Expression and activity of phenate dehydratase PheA, tyrosine transaminase TyrB, shikimate kinases AroK and AroL, 5-enolpyruvylshikimate-3-phosphate synthase AroA, chorismate synthase AroC in the shikimate pathway , obtain the recombinant Escherichia coli TYR042 with greatly improved tyrosine production capacity. The Escherichia coli genetically engineered bacterium TYR042 constructed by the present invention can produce 45g / L tyrosine by fermenting sugary raw materials by using inorganic salt medium, and has the application prospect of industrial fermentation to produce tyrosine.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a tyrosine-producing Escherichia coli genetically engineered bacterium and a construction method and application thereof. Background technique [0002] As an important precursor of aromatic chemicals, aromatic amino acids have considerable industrial value. Through the derivation and transformation of different aromatic amino acids, many aromatic chemicals with different application prospects can be synthesized. As an aromatic amino acid, tyrosine has a wide range of applications. [0003] On the one hand, L-Tyrosine itself can be used as a food additive. According to literature reports, tyrosine can increase brain activity to improve memory, and can control appetite to control anxiety and depression. In addition, tyrosine is an essential dietary supplement for patients with phenylketonuria who lack the enzyme that converts phenylalanine into tyrosine. On the other hand...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/21C12N15/90C12P13/22C12R1/19
Inventor王钦宏曹鹏陈五九彭彦峰吴凤礼张媛媛
OwnerTIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI