Kit for quantitative detection of cassava component based on micro-drop digital PCR and application thereof

A quantitative detection, droplet technology, applied in the field of molecular biology, can solve the problems affecting the accuracy of the result judgment, etc., and achieve the effect of good specificity

Active Publication Date: 2019-06-25
INSPECTION & QUARANTINE TECH CENT OF GUANGDONG ENTRY EXIT INSPECTION & QUARANTINE BUREAU
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The above methods are easily affected by factors such as variety and harvest season, and are also easily limited by sampling uniformity and representativeness, which will affect the accuracy of result judgment.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for quantitative detection of cassava component based on micro-drop digital PCR and application thereof
  • Kit for quantitative detection of cassava component based on micro-drop digital PCR and application thereof
  • Kit for quantitative detection of cassava component based on micro-drop digital PCR and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Validation of specificity of cassava components

[0055] Genomic DNA of cassava, cassava, sweet potato, yam, taro, eggplant, carrot, tomato, celery, rice, soybean and barley were extracted respectively, and the extracted genomic DNA was used as a template, and the upstream primer of mSOD2 gene (tgcaagcaaagaacaaaatcgt, SEQ ID No. .1), the downstream primer of mSOD2 gene (cacaacattttccatcacaaaaaca, SEQ ID No.2) and the probe of mSOD2 gene (attaaacttctggctggtttgccccgt, SEQ ID No.3) were amplified by fluorescent quantitative PCR, and the reaction procedure of qPCR was as follows: 95°C, 5min , 1°C / s; 94°C, 15s, 1°C / s, 60°C, 1min, 1°C / s, a total of 40 cycles; 98°C, 10min, 1°C / s. Amplification curve see figure 1 , of which only cassava has a typical S-type expansion curve, and other crops have no typical expansion curve. It shows that the primer probe designed in the present invention is specific for the detection of cassava, and has good specificity.

Embodiment 2

[0057] Linear relationship between cassava mass (mg) and copy number concentration (copies / μL)

[0058] Weigh 5 mg, 15 mg, 30 mg, 40 mg, and 50 mg of cassava flour samples in gradient quality, and use Wizard Genomic DNA purification kit (Promega, A1120) to extract genomic DNA, and use 20 μL digital PCR reaction system (2×ddPCRTM master mix 10 μL; primer concentration of 10 μmol / μL 0.5 μL each, 0.5 μL probe with a concentration of 10 μmol / μL, 2 μL DNA template, and water up to 20 μL. The ddPCR reaction conditions are: 95 °C, 5 min (1 °C / s); 94 °C, 15 s (1 °C / s), 60°C, 1min (1°C / s), a total of 40 cycles; 98°C, 10min (1°C / s), 12°C to store the reaction product. After the amplification, place the 96-well plate in the droplet analyzer to read Fluorescence signal, and use QuantaSoft V1.3.2 software to analyze the experimental data.

[0059] The obtained data are shown in Table 1, and the linear relationship data between cassava mass (mg) and copy number concentration (copies / μL) ar...

Embodiment 3

[0064] Determination of the Limit of Detection (LOD) and Limit of Quantification (LOQ) of Cassava DNA Concentration

[0065] The linear relationship between the copy number concentration and DNA concentration detected by cassava-specific gene digital PCR: the DNA concentration gradients were 18ng / μL, 3.6ng / μL, 1.8ng / μL, 0.6ng / μL and 0.2ng / μL, and each gradient was three parallel. Judgment conditions are: LOQ is the lowest copy number concentration corresponding to the relative standard deviation (RSD) of the detection result being less than 25%, and LOD is the lowest copy number concentration that can be detected by no less than 9 out of 10 parallels. The data of cassava DNA concentration copy number test result are shown in Table 2. The heat map of cassava DNA concentration copy number test is shown in image 3 . The heat map of cassava DNA concentration gradient LOD and LOQ test is shown in Figure 4.

[0066] Table 2 cassava DNA concentration copy number test results

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a kit for quantitatively detecting cassava components based on micro-drop digital PCR and an application thereof, and belongs to the technical field of molecular biology. The kit comprises an upstream primer of an mSOD2 gene, a downstream primer of the mSOD2 gene and a probe of the mSOD2 gene. The application of the kit in the quantitative detection of the cassava componentin a sample is further provided. The method includes utilizing a digital PCR system to detect a cassava-specific single-copy species gene mSOD2 fluorescence signal to obtain the measured cassava-specific species gene mSOD2 copy number concentration, and the content of the cassava component is calculated according to the linear relationship between the copy number concentration (copy number / [mu]L)and the cassava mass (mg). The kit can specifically and quantitatively detect the cassava component, and has the advantages of being simple, rapid and high in detection sensitivity.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and in particular relates to a kit for quantitatively detecting cassava components based on droplet digital PCR and an application thereof. Background technique [0002] Cassava (Manihot esculenta Crantz) is a crop in the south of the Yangtze River in China. It can tolerate poor soil and has strong adaptability. Its high starch content can be used as an energy source, and it can also produce tapioca starch for food processing. Due to its low price, it is often mixed into high-value starch products such as sweet potato powder and water chestnut powder. Therefore, the market supply of goods that meet the requirements, especially for trade activities with high value, requires quantitative identification technology with high sensitivity and accuracy to complete the identification, so as to maintain market fairness and order. [0003] Due to the similar physical appearance of starches, it ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6895C12Q1/6851
Inventor刘二龙李志勇蒋湘关丽军董旭婉刘婧文
OwnerINSPECTION & QUARANTINE TECH CENT OF GUANGDONG ENTRY EXIT INSPECTION & QUARANTINE BUREAU