SNP site detection kit for guiding diabetes medication and use method thereof
A detection kit and diabetes technology, applied in the field of genetic diagnosis, can solve problems such as organ dysfunction, affecting daily life, life-threatening, etc., and achieve the effects of simplified operation, reduced experimental cost, and high accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] In order to overcome the deficiencies of the existing technology, we invented a method for detecting the efficacy and sensitivity of diabetes medications. This method detects 10 sites including 8 genes, namely CYP2C9 (rs1057910), KCNJ11 (rs5219), ABCC8 (rs757110, rs1799854), TCF7L2 (rs12255372, rs7903146), LC22A1 (rs72552763), SLC22A2 (rs316019), PPARG (rs1801282), LCO1B1 (rs4149056).
[0050] The invention provides a SNP site detection kit for guiding diabetes medication, comprising an amplification PCR reaction system, the amplification PCR reaction system includes a PCR premix and multiple pairs of PCR primers, and the PCR primers are shown in Table 1 Shown:
[0051] rs5219 upstream primer GCACTCCTCAGTCACCATGC rs5219 downstream primer TGTCCCGCAAGGGCATCAT rs1057910 upstream primer GCACGAGGTCCAGAGATACAT rs1057910 downstream primer AATGGAAAGCCTCAACGTGT rs1799854 upstream primer GGCTAGAAGGAGCGAGGACT rs1799854 downstream primer...
Embodiment 2
[0068] Take 10ul of the product amplified by a single pair of primers for agarose gel electrophoresis detection, the detection results are shown in figure 2 , the electropherogram showed that the size of the sample amplification band was in line with the expectation, and the band was bright without non-specific amplification bands, indicating that the primers had good stability and specificity.
[0069] Combine all the primers and perform multiplex PCR amplification. Take 10ul of the product for agarose gel electrophoresis detection. The detection results are shown in image 3 , the product presents a ladder shape, indicating that the primers will not interfere with each other during PCR amplification.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


