Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

SNP site detection kit for guiding diabetes medication and use method thereof

A detection kit and diabetes technology, applied in the field of genetic diagnosis, can solve problems such as organ dysfunction, affecting daily life, life-threatening, etc., and achieve the effects of simplified operation, reduced experimental cost, and high accuracy

Pending Publication Date: 2019-07-02
NANJING GEZHI GEMONICS CO LTD
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Poor control of blood sugar level will lead to many acute and chronic complications, cause dysfunction of multiple organs throughout the body, affect daily life, and even lead to life-threatening

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SNP site detection kit for guiding diabetes medication and use method thereof
  • SNP site detection kit for guiding diabetes medication and use method thereof
  • SNP site detection kit for guiding diabetes medication and use method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] In order to overcome the deficiencies of the existing technology, we invented a method for detecting the efficacy and sensitivity of diabetes medications. This method detects 10 sites including 8 genes, namely CYP2C9 (rs1057910), KCNJ11 (rs5219), ABCC8 (rs757110, rs1799854), TCF7L2 (rs12255372, rs7903146), LC22A1 (rs72552763), SLC22A2 (rs316019), PPARG (rs1801282), LCO1B1 (rs4149056).

[0050] The invention provides a SNP site detection kit for guiding diabetes medication, comprising an amplification PCR reaction system, the amplification PCR reaction system includes a PCR premix and multiple pairs of PCR primers, and the PCR primers are shown in Table 1 Shown:

[0051] rs5219 upstream primer GCACTCCTCAGTCACCATGC rs5219 downstream primer TGTCCCGCAAGGGCATCAT rs1057910 upstream primer GCACGAGGTCCAGAGATACAT rs1057910 downstream primer AATGGAAAGCCTCAACGTGT rs1799854 upstream primer GGCTAGAAGGAGCGAGGACT rs1799854 downstream primer...

Embodiment 2

[0068] Take 10ul of the product amplified by a single pair of primers for agarose gel electrophoresis detection, the detection results are shown in figure 2 , the electropherogram showed that the size of the sample amplification band was in line with the expectation, and the band was bright without non-specific amplification bands, indicating that the primers had good stability and specificity.

[0069] Combine all the primers and perform multiplex PCR amplification. Take 10ul of the product for agarose gel electrophoresis detection. The detection results are shown in image 3 , the product presents a ladder shape, indicating that the primers will not interfere with each other during PCR amplification.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a SNP site detection kit for guiding diabetes medication and use method thereof. The kit includes an amplification PCR reaction system, the amplification PCR reaction system comprises a PCR premix liquid and a plurality of pairs of PCR primers, through the multiple pairs of the PCR primers, 10 sites of 8 genes can be simultaneously detected, namely CYP2C9(rs1057910), KCNJ11(rs5219), ABCC8(rs757110, rs1799854), TCF7L2(rs12255372, rs7903146), SLC22A1(rs72552763), SLC22A2(rs316019), PPARG(rs1801282), and SLCO1B1(rs4149056), and the sequencing results guide the diabetes medication for patients. The 10 sites are detect and simultaneously amplified by adopting the method of multiplex PCR amplification, and the single reaction system amplification not only simplifies theoperation, reduces the possibility of errors, but also reduces the experiment cost. In addition, the guiding medication of the present invention cover four major classes of diabetes drugs: sulfonylureas, biguanides, thiazolidinediones and meglitinides, and the detection and analysis of 10 sites of related genes is more extensive than similar products on the market.

Description

technical field [0001] The invention belongs to the technical field of gene diagnosis, and in particular relates to a SNP site detection kit for guiding diabetes medication and a use method thereof. Background technique [0002] Type 2 diabetes mellitus is a metabolic disease caused by insufficient insulin secretion or insensitivity of peripheral tissues to insulin. , nerves, etc.) long-term damage, insufficiency or failure. In 2017, it is estimated that about 415 million people in the world suffer from diabetes, and China has about 118 million, accounting for 27%, ranking first in the world. With the rapid development of the economy and the acceleration of industrialization, the change of lifestyle and the aggravation of the aging trend, the prevalence of diabetes is still on the rise, and it has become another disease that seriously endangers people's health after cardiovascular and cerebrovascular diseases and tumors. Important chronic non-communicable diseases. In 201...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883C12Q1/6869
CPCC12Q1/6883C12Q1/6869C12Q2600/156C12Q2600/106C12Q2600/16C12Q2531/113C12Q2537/143
Inventor 林东旭卢艳娇刘小龙魏国鹏
Owner NANJING GEZHI GEMONICS CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com