Recombinant bacterium capable of using whole-cell transformation method to produce N-acetylneuraminic acid in high-yield manner and application

A technology of acetylneuraminic acid and whole cell transformation, applied in the field of genetic engineering, can solve the problems of low N-acetylneuraminic acid production and N-acetylglucosamine conversion rate, insufficient expression of key enzyme genes, etc., and achieve the effect of strengthening expression

Inactive Publication Date: 2019-07-05
JIANGNAN UNIV
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the production of N-acetylneuraminic acid by the Bacillus subtilis whole-cell transformation method, there are accumulation of the intermediate product N-acetylmannosamine, insufficient expression of key enzyme genes, and the consumption of the substrate pyruvate to produce the by-product acetoin, which may be caused by This leads to the current situation that the yield of N-acetylneuraminic acid and the conversion rate of N-acetylglucosamine are low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant bacterium capable of using whole-cell transformation method to produce N-acetylneuraminic acid in high-yield manner and application
  • Recombinant bacterium capable of using whole-cell transformation method to produce N-acetylneuraminic acid in high-yield manner and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 Construction of recombinant plasmids with different expression strengths of ShNanA

[0038] According to the N-acetylglucosamine isomerase gene (age) synthetic gene in Anabaena sp.CH1 (GenBank: DQ661858.1) published on NCBI, the primers were designed:

[0039] AGE-F: 5’-TAATCTGTAACTCGAGAAAGGAGGAAGGATCAATGGGCAA-3’,

[0040] AGE-R: 5’-ACGTAGGTGGTGTGGCCCGGGTTATGAAAGTGCTTCAAAC-3’,

[0041] Using the above primers, the synthesized N-acetylglucosamine isomerase gene is used as a template to amplify the age gene fragment.

[0042] According to the N-acetylneuraminic acid aldolase gene (shnanA) of Staphylococcus hominis published on NCBI, the gene was synthesized, and the primers were designed: Shnal-F:5'-TATAAAGTGATAGCGGTACCATTATAGGTAAGAGAGGAATGTACACTCTAGAATGGAAGA ACAGCTGAAA-3',Shnal-R :5'-CCATTGATCCTTCCTCCTTTCTCGAGTTACAGATTATATGTTTCAATCAGCTGG-3',

[0043] Using the above primers, the synthetic N-acetylneuraminic acid aldolase (ShNanA) gene was used as a template to amplify sh...

Embodiment 2

[0045] Example 2 Construction of recombinant Bacillus subtilis with different expression intensities of ShNanA

[0046] The constructed p43ANsh and p43ANshN1 plasmids were transformed into Bacillus subtilis B6CG. The AGE-F and AGE-R primers designed in Example 1 were used to select transformants for colony PCR. After gel electrophoresis, a 1167bp band appeared, which verified the recombinant Bacillus subtilis spores. Bacillus B6CG / p43ANsh and B6CG / p43ANshN1 were successfully constructed.

Embodiment 3

[0047] Example 3 Construction of Recombinant Bacillus Subtilis Blocking Acetoin Production

[0048] 1) Construction of recombinant fragments

[0049] Using the Bacillus subtilis B6CG genome as a template, the upstream primer AlsSDL-F: 5'-GCAAGTATTGTTCATGTACCTGCATCACTCTCTT-3' and the downstream primer AlsSDL-R: 5'-ACTCCTTATTATGCATTTTAAACGTAA-3' were used to amplify the upstream of the genes to be knocked out alsS and alsD Recombinate the homologous left arm fragment, and use the Bacillus subtilis B6CG genome as the template to use the upstream primer AlsSDR-F: 5'-AGAAAGCCCCTTTTAGCAGGG-3', and the downstream primer AlsSDR-R: 5'-CCCTACTGCGCTGTCAGAAGCAAAATCAG-3' to amplify the same Source recombinant right arm fragment. Use plasmid P7z6 as template to pass upstream primers

[0050] P7z6-F: 5'-TAAAATGCATAATAAGGAGTCTCGCCTATTGTTAAAGTGTGTCCTT-3', and the downstream primer P7z6-R: 5'-GCCCTGCTAAAAGGGGCTTTCTATTGCGGTCCCAAAAGGGTCAGTGC-3', amplify the zeocin resistance gene containing lox72 and ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant bacterium capable of using a whole-cell transformation method to produce N-acetylneuraminic acid in a high-yield manner and application and belongs to the field of genetic engineering. The recombinant bacterium is characterized in that bacillus subtilis is used as the expression host to overexpress N-acetylglucosamine isomerase (AGE) from anabaena and N-acetylneuraminic acid aldolase (ShNanA) from staphylococcus haemolyticus, the N terminal encoding sequence of gene tufA is further fused to the 5'-terminla of the ShNanA encoding sequence, and the recombinant bacillus subtilis capable of producing the N-acetylneuraminic acid in a high-yield manner is obtained by knocking out the related genes alsS and alsD for generating byproduct acetoin. The recombinant bacterium has the advantages that the recombinant bacterium can be used to produce the N-acetylneuraminic acid through whole-cell transformation, the yield of the N-acetylneuraminic acid reaches 93.78g / L, the mole transformation rate of the N-acetylglucosamine is 50.54%, and a foundation is laid for the N-acetylneuraminic acid production using bacillus subtilis engineering.

Description

Technical field [0001] The invention relates to a recombinant bacterium with high production of N-acetylneuraminic acid by a whole cell transformation method and application thereof, and belongs to the field of genetic engineering. Background technique [0002] N-acetylneuraminic acid (NeuAc) is the most ubiquitous species of sialic acid. It occupies the terminal position of glycoprotein, glycolipid or oligosaccharide in the cell membrane. It plays an important role in cell recognition, signal transduction, tumorigenesis and fertilization. Because of its important functions in biology, pathology and immunology, NeuAc has been used as a drug in the treatment of cancer, inflammation and influenza, and has important applications. It is also used to enhance immunity and promote infant brain development. Health products. [0003] Whole-cell biocatalytic reaction conditions are mild, can realize continuous multi-step catalytic reaction, can produce the desired product with high conversi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/61C12N15/60C12N15/75C12P13/02C12R1/125
CPCC12N9/88C12N9/92C12N15/75C12P13/02C12Y401/03003
Inventor刘延峰堵国成刘龙李江华赵林陈坚
OwnerJIANGNAN UNIV