Vector combination for quick gene editing of halomonas sp. and application of vector combination

A Halomonas and gene editing technology, applied in the field of genetic engineering, can solve the problems of cost, prolongation, and impossibility of knockout, etc., and achieve the effect of rapid gene editing, simplified steps, and reduced time

Active Publication Date: 2019-07-05
BLUEPHA CO LTD +1
View PDF12 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Secondly, after the second homologous recombination, the chimera will randomly become wild type or recombinant type. If the recombinant type is successfully obtained, the whole process will take 17-19 days. It is necessary to repeat the steps to help the plasmid into the chimera, resulting in an extension of nearly 10 days in the whole process, so it usually takes nearly 1 month to edit a gene locus, which means that it takes N months to edit N genes , seriously affecting the efficiency of gene editing and bacterial transformation
Finally, there are essential genes in Halomonas TD01, but many essential genes cannot be predicted and need to be proved by experiments
When the target gene to be knocked out in Halomonas TD01 cannot be recombined even after repeated knockout attempts, and all obtained after the second homologous recombination are wild-type, it will be speculated that the gene is an essential gene , the knockout could not be achieved, but the whole process had taken more than a month when this conclusion was reached
Therefore, the existing gene editing methods in Halomonas TD01 have been difficult to meet the increasing needs of genetic modification, and a faster gene editing method is urgently needed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vector combination for quick gene editing of halomonas sp. and application of vector combination
  • Vector combination for quick gene editing of halomonas sp. and application of vector combination
  • Vector combination for quick gene editing of halomonas sp. and application of vector combination

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1: Construction of a vector for gene editing of Halomonas TD01 based on CRSIPR / Cas9

[0049] Using primers to pCas plasmid (Jiang, Y., Chen, B., Duan, C., Sun, B., Yang, J., Yang, S., 2015. Multigene editing in the Escherichia coli genome via the CRISPR-Cas9system .Appl.Environ.Microbiol.81, 2506-2514) was amplified as a template to obtain a DNA fragment containing a promoter, a cas9 gene and a terminator, and was connected into pSEVA321 (Silva-Rocha, R., de Lorenzo, V., 2013. The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Res. 41, 666–675.) Between the XmaI and SacII sites, the cas9 expression vector pQ08 was obtained. The primers used are as follows:

[0050]

[0051]

[0052] The resulting vector sequence is:

[0053]

[0054] Primers were used to amplify pSEVA341 (Silva-Rocha, R., de Lorenzo, V., 2013. The Standard European Vector Architecture (SEVA...

Embodiment 2

[0063] Example 2: Knockout of the phaC gene of Halomonas TD01 based on CRISPR / Cas9

[0064] In the phaC gene sequence of Halomonas TD01, gataacattgccgtcacccc (SEQ ID NO: 13) was selected as gRNA, and the corresponding PAM sequence was AGG. Use primers AGCCGAAGACTGTAGTGATAACATTGCCGTCACCCC (SEQ ID NO: 14) and TACAGAAGACAGAAACGGGGTGACGGCAATG (SEQ ID NO: 15) to perform template-free PCR to obtain a 52bp fragment containing gRNA, which is connected between the BbsI sites of pHALORNA by the Golden Gate ligation method. At the same time, using the genome of Halomonas TD01 (preserved in the General Microorganism Center of China Microbiological Culture Collection Management Committee, the preservation number is CGMCCNo.4353) as a template, primers TAAAGGTCTCAGCGGGAAGCATGGAAAGTGCAGCT (SEQ ID NO: 16) and TTCTCACGCAGTGCAGCGCATGACTTCGGG (SEQ ID NO : 17) Amplify the upstream sequence of the homology arm of 522bp, and amplify the downstream sequence of the homology arm of 520bp with primers ...

Embodiment 3

[0079] Example 3: Inserting exogenous genes into the genome of Halomonas TD01 based on CRISPR / Cas9

[0080]In the genome sequence of Halomonas TD01, ttcacctagctagatgagac (SEQ ID NO: 30) was selected as the gRNA of the insertion site, and the corresponding PAM sequence was AGG. Use primers AGCCGAAGACTGTAGTTTCACCTAGCTAGATGAGAC (SEQ ID NO: 31) and TACAGAAGACAGAAACGTCTCATCTAGCTAG (SEQ ID NO: 32) to perform template-free PCR to obtain a 52bp fragment containing gRNA, which is connected between the BbsI sites of pHALORNA by the Golden Gate ligation method. At the same time, using the genome of Halomonas TD01 as a template, use primers to amplify the upstream sequence of the homology arm, and use another pair of primers to amplify the downstream sequence of the homology arm; using the genome of Halomonas TD01 as a template, use The primers were amplified to obtain a fragment containing the porin promoter; G.Q.,2005.Poly(3-hydroxybutyrate-co-3-hydroxyhexanoate)production inrecombinan...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a vector combination for quick gene editing of halomonas sp. and an application of the vector combination. The vector combination comprises a cas9 expression vector and an sgRNAexpression vector, wherein the cas9 expression vector is obtained by introducing cas9 genes into a plasmid vector, and the cas9 expression vector does not contain lambda-RED recombinase genes. Compared with a conventional gene editing means for halomonas sp., the vector combination is quicker, only 8 days are needed for the flow for performing gene editing once, and the reforming efficiency of the halomonas sp. is greatly improved. In addition, the vector combination is used for the halomonas sp., and a gene editing method based on CRISPR / Cas9 is used for performing continuous editing (knockout and insertion) of a plurality of genes, so that the required time can be greatly shortened.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a carrier combination for rapid gene editing in Halomonas and its application. Background technique [0002] Halomonas sp. TD01 (preservation number is CGMCC No.4353) disclosed in CN102120973A is a Gram-negative halophilic bacterium screened from the soil sample of Aiding Lake, Xinjiang Province, China, because it can achieve no Sterile open continuous fermentation has brought a breakthrough technology for low-cost production of industrial fermentation. The optimal growth condition of Halomonas TD01 is a high-salt and high-alkali environment, in which non-halophilic bacteria cannot grow, so the fermentation process of Halomonas TD01 can be carried out under open and non-sterile conditions, thereby It directly reduces the energy consumption cost caused by sterilization in fermentation production. The salt concentration in the high-salt environment where Halomonas T...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/74C12N15/113C12N1/21C12R1/01
CPCC12N15/74C12N15/113C12N2310/10
Inventor陈国强秦琴尹进相瑞娟郭瑛瑛
OwnerBLUEPHA CO LTD