Oligonucleotide chain probe participating in polymerization extension and nucleic acid amplification kit thereof
A technology of oligonucleotides and kits, applied in the field of bioengineering, can solve problems such as the source of sequence-specific fluorescent signals, and achieve the effect of improving reaction efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Example 1 A molecular beacon involved in nucleic acid sequence polymerization extension is applied to a loop-mediated isothermal amplification (loop-mediated isothermal amplification, LAMP) system
[0046] 1. Setting of LAMP reaction system and reaction conditions
[0047] 1. LAMP reaction system (25 μL):
[0048] Template 2 μL (DNA content is 1000 orders of magnitude, 100 orders of magnitude and 10 orders of magnitude respectively);
[0049] Tris-HCl (pH=8.8) 20mM, KCl 10mM, (NH4) 2 SO 4 10mM, betaine 0.8M, MgSO 4 8mM, dNTP 1.4mM, Tween20 0.25μL, Bst DNA polymerase 8U,
[0050] 5 pmol each of primer F3 and primer B3, 40 pmol each of primer FIP and primer BIP, 20 pmol each of primer LF and primer LB, and 20 pmol each of conventional and tailed molecular beacon probes. Each molecular beacon primer combination was set up in triplicate.
[0051] 2. LAMP reaction conditions: react at 64°C for 45 minutes, collect fluorescence once every minute.
[0052] 2. Primer de...
Embodiment 2
[0099] Example 2 An oligonucleotide chain probe involved in polymerization extension is applied to hyperbranched rolling cycle amplification (Hyperbranched rolling cycle amplification, HRCA)
[0100] The specific sequence at both ends of the padlock probe is complementary to the target sequence, the connecting sequence between the specific sequences is designed as a universal sequence, and a universal primer and an oligonucleotide probe involved in polymerization extension are designed for this sequence. The gap of the padlock probe corresponds to the nucleic acid variation site, and only when the specific sequences at both ends of the padlock probe are completely complementary to the target sequence, the padlock probe will form a (single-stranded) loop under the action of ligase. An important application of padlock probes is the detection of point mutations.
[0101] 1. Design of sequences, primers and probes for HRCA reaction
[0102] The sequence of the universal sequence ...
Embodiment 3
[0122] Example 3 An oligonucleotide chain probe involved in polymerization extension is applied to recombinase polymerase amplification technology (Recombinase Polymerase Amplification, RPA)
[0123] 1. Sequences, primers and probes for RPA reactions
[0124] 1. The sequence of the template plasmid ASFV-RPA clone is the partial sequence (96-395) of the B646L gene (encoding VP72 outer membrane protein) of African swine fever virus (Georgia-2 strain, genebank number MH910496.1), African swine fever virus Georgia -The 1-420 sequences of the two B646L genes are as follows:
[0125]
[0126]
[0127] 2. RPA primers and probes
[0128] P3-F: TGAACAAAAGTTATGGGAAACCCGATCCCGAA (SEQ ID NO: 20)
[0129] P3-R: ATCTGGGACGTGCCCTGAATCGGAGCATCCT (SEQ ID NO: 21)
[0130] exo probe: CGTATGCGGGCGTACTTTTATTGTATTCAAA-FAM-dT-C-THF-T-BHQ1-dT-CTGGAACATAAGGCTT (SEQ ID NO: 22)
[0131] An oligonucleotide strand probe MB involved in polymerization elongation:
[0132] FAM-aagtacgcCGTATGCGGGCG...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap