Supercharge Your Innovation With Domain-Expert AI Agents!

Oligonucleotide chain probe participating in polymerization extension and nucleic acid amplification kit thereof

A technology of oligonucleotides and kits, applied in the field of bioengineering, can solve problems such as the source of sequence-specific fluorescent signals, and achieve the effect of improving reaction efficiency

Pending Publication Date: 2019-07-09
QUICKING BIOTECH +1
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, the first object of the present invention is to provide a kind of oligonucleotide chain probe that participates in polymerization extension, to solve the sequence-specific fluorescent signal source problem in the gene amplification that exists in existing nucleic acid amplification reaction

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Oligonucleotide chain probe participating in polymerization extension and nucleic acid amplification kit thereof
  • Oligonucleotide chain probe participating in polymerization extension and nucleic acid amplification kit thereof
  • Oligonucleotide chain probe participating in polymerization extension and nucleic acid amplification kit thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1 A molecular beacon involved in nucleic acid sequence polymerization extension is applied to a loop-mediated isothermal amplification (loop-mediated isothermal amplification, LAMP) system

[0046] 1. Setting of LAMP reaction system and reaction conditions

[0047] 1. LAMP reaction system (25 μL):

[0048] Template 2 μL (DNA content is 1000 orders of magnitude, 100 orders of magnitude and 10 orders of magnitude respectively);

[0049] Tris-HCl (pH=8.8) 20mM, KCl 10mM, (NH4) 2 SO 4 10mM, betaine 0.8M, MgSO 4 8mM, dNTP 1.4mM, Tween20 0.25μL, Bst DNA polymerase 8U,

[0050] 5 pmol each of primer F3 and primer B3, 40 pmol each of primer FIP and primer BIP, 20 pmol each of primer LF and primer LB, and 20 pmol each of conventional and tailed molecular beacon probes. Each molecular beacon primer combination was set up in triplicate.

[0051] 2. LAMP reaction conditions: react at 64°C for 45 minutes, collect fluorescence once every minute.

[0052] 2. Primer de...

Embodiment 2

[0099] Example 2 An oligonucleotide chain probe involved in polymerization extension is applied to hyperbranched rolling cycle amplification (Hyperbranched rolling cycle amplification, HRCA)

[0100] The specific sequence at both ends of the padlock probe is complementary to the target sequence, the connecting sequence between the specific sequences is designed as a universal sequence, and a universal primer and an oligonucleotide probe involved in polymerization extension are designed for this sequence. The gap of the padlock probe corresponds to the nucleic acid variation site, and only when the specific sequences at both ends of the padlock probe are completely complementary to the target sequence, the padlock probe will form a (single-stranded) loop under the action of ligase. An important application of padlock probes is the detection of point mutations.

[0101] 1. Design of sequences, primers and probes for HRCA reaction

[0102] The sequence of the universal sequence ...

Embodiment 3

[0122] Example 3 An oligonucleotide chain probe involved in polymerization extension is applied to recombinase polymerase amplification technology (Recombinase Polymerase Amplification, RPA)

[0123] 1. Sequences, primers and probes for RPA reactions

[0124] 1. The sequence of the template plasmid ASFV-RPA clone is the partial sequence (96-395) of the B646L gene (encoding VP72 outer membrane protein) of African swine fever virus (Georgia-2 strain, genebank number MH910496.1), African swine fever virus Georgia -The 1-420 sequences of the two B646L genes are as follows:

[0125]

[0126]

[0127] 2. RPA primers and probes

[0128] P3-F: TGAACAAAAGTTATGGGAAACCCGATCCCGAA (SEQ ID NO: 20)

[0129] P3-R: ATCTGGGACGTGCCCTGAATCGGAGCATCCT (SEQ ID NO: 21)

[0130] exo probe: CGTATGCGGGCGTACTTTTATTGTATTCAAA-FAM-dT-C-THF-T-BHQ1-dT-CTGGAACATAAGGCTT (SEQ ID NO: 22)

[0131] An oligonucleotide strand probe MB involved in polymerization elongation:

[0132] FAM-aagtacgcCGTATGCGGGCG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an oligonucleotide chain probe participating in polymerization extension. A minimum free energy structure of the oligonucleotide chain probe is of a stem-loop structure, and the sequence of the oligonucleotide chain probe sequentially comprises the following four sections from the 5'end to the 3'end: a stem structure sequence MB-J, a loop sequence MB-H, a stem structure complementary sequence MB-Jc and a single-chain tail sequence MB-P, wherein a fluorescent quenching group and a fluorescent group are respectively connected to the 5'end of the MB-J and an intermediate base of the MB-Jc chain, and two connection positions are adjacent in the stem-loop structure; and the MB-H and MB-P are all or partially complementary to a target sequence; and the 3'end of the MB-P is complementary to the target sequence and can be extended and polymerized. The oligonucleotide chain probe participating in the polymerization extension has the functions of primers and molecular beacons. The invention further discloses a constant-temperature nucleic acid amplification kit, which comprises the oligonucleotide chain probe participating in the polymerization extension.

Description

technical field [0001] The invention belongs to the field of bioengineering, and in particular relates to an oligonucleotide chain probe involved in polymerization extension and a nucleic acid amplification kit thereof. Background technique [0002] DNA-specific amplification technology and detection technology, and various applications developed on this basis are developing rapidly. In clinical testing, the concept of point-of-care testing (POCT) is rapidly emerging. From simple dry chemical technology to sensing and biochips, its testing items cover almost all medical testing fields. The combination of POCT and nucleic acid amplification requires portable and stable instruments, easy method operation, fast, clear and reliable results, and even comparable standards. As a result, a large number of improvements and inventions in methods, reagents, and instruments have been produced. [0003] A large number of isothermal DNA amplification techniques are used in POCT, includi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12Q1/6844
CPCC12Q1/6844C12Q2537/1376C12Q2531/119C12Q2563/107
Inventor 周中人许向华张磊张桂平
Owner QUICKING BIOTECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More