Gene methylation detection method, detection kit and application thereof
A technology for detection kits and detection methods, applied in the direction of DNA / RNA fragments, recombinant DNA technology, etc., can solve the troublesome and complicated analysis of quantitative methods, single-strand detection of gene methylation does not fully consider the overall methylation of the two strands of the gene Level and other issues
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0117] The following will clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only some of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by persons of ordinary skill in the art without making creative efforts belong to the protection scope of the present invention.
[0118] Materials: plasma samples to be tested, methylation-positive DNA at a concentration of 2ng / ul, and methylation-negative DNA at a concentration of 2ng / ul.
[0119] Instruments: Lightcycler 480, rotary mixer, water bath, vortex oscillator, refrigerator.
[0120] Reagents: DNA polymerase (Roche), 10×PCR Buffer (Roche), MgCl 2 (Roche), dNTP (TaKaRa), purified water.
[0121] Primers and probes: The purity of all primers should reach electrophoresis grade (PAGE) or HPLC grade, free of impurities. The reporter fl...
Embodiment 2
[0153] The inventors also performed double-strand detection of HOXA9 gene methylation.
[0154] Probe for sense strand: AAATTACCGACGCCCGCG
[0155] Forward primer for sense strand: TTATTGTTTTGTTGGACGGGTACG
[0156] Reverse primer for sense strand: AATTTCATATAACAACTTAATAACACCG
[0157] Probe for antisense strand: AAACGAACACGTAACGCG
[0158] Forward primer for antisense strand: CGTTCGCGTTTTTATTGGTC
[0159] Reverse primer for antisense strand: CGAACCATTAATAACGTACGAA
[0160] 20 plasma samples from lung cancer and 13 plasma samples from healthy people were tested. HOXA9 gene methylation detection was performed on plasma samples using the above-mentioned double-strand detection method. The internal reference gene ACTB of all plasma samples was amplified and the Cp value was less than 40, which proved that the experiment was accurate and effective. Observing the target gene channel and counting the detection results, the internal reference gene ACTB of all plasma samples was ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



