Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Preparation and application of LncRNA-COX2 small interfering RNA

A technology of RNA interference and small interference, applied in the field of biotechnology and medicine, can solve the problems of unexplained core mechanism and complex pathogenic mechanism of tuberculosis, and achieve the effect of promoting apoptosis and broad application prospects

Inactive Publication Date: 2019-07-09
NINGXIA UNIVERSITY
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the complex pathogenic mechanism of tuberculosis, it is regulated by various biology, but its core mechanism has not yet been elucidated

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation and application of LncRNA-COX2 small interfering RNA
  • Preparation and application of LncRNA-COX2 small interfering RNA
  • Preparation and application of LncRNA-COX2 small interfering RNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0073] Example 1: Changes in the expression of LncRNA-COX2 after BCG infection of RAW264.7 cells

[0074] BCG was respectively infected (MOI 1:10) cells for 0h, 6h, 12h, 18h, and 24h to collect the cells, extract the total RNA of RAW264.7 cells, reverse transcribe and perform Q-PCR analysis, and set up normal controls (wt, Wild RAW264.7 cells) group.

[0075] Specific steps are as follows:

[0076] 1) RT-PCR: The total RNA of RAW264.7 cells was extracted according to the operation steps of the total RNA extraction kit manual of Beijing Tiangen Biochemical Technology Co., Ltd., the quality of RNA was identified by electrophoresis, and quantified by ultraviolet spectrophotometer. Take 1 μg of total RNA, configure 20 μL of a fluorescence quantitative reaction system according to the instructions of the full-type gold TransStart One-Step cDNA Synthesis SuperMix, and perform reverse transcription according to the instructions of the instructions.

[0077] 2) Q-PCR: Select 1 μL of...

Embodiment 2

[0085] Example 2: Expression position of LncRNA-COX2 after BCG infection of RAW264.7 cells

[0086] After BCG infected macrophage RAW264.7 cells for 12 hours, FISH probe detection technology was used to locate LncRNA-COX2 and determine the expression position of LncRNA-COX2.

[0087] The nucleic acid sequence in the FISH probe is the following sequence; the fluorescent molecule is DAPI, which is connected to the 5' end of the sequence.

[0088] 5'aaagccggctttttcacaac3'

[0089] 5'aaatgctctcctacttgcca3'

[0090] 5'gaaaagtttccaggaaggga3'

[0091] Specific steps are as follows:

[0092] FISH probe detection:

[0093] (1) One day before infection, 5×10 per well 5 The cells were seeded in a six-well plate, and 2 mL of DEME medium containing 10% FBS was added to each well, and the 2 cultured in an incubator.

[0094] (2) Change the medium before infection, 2 mL of DMEM medium containing 10% FBS in each well of a 6-well plate, and infect with BCG (MOI 1:10).

[0095] (3) Aspira...

Embodiment 3

[0111] Example 3: Analysis of the expression level of LncRNA-COX2 after small interfering RNA interference of LncRNA-COX2

[0112] LncRNA-COX2 small interfering RNA siRNA-COX2-1 and siRNA-COX2-2 were transiently transfected into mouse macrophages 24 hours after BCG infection, and the cells were harvested at 48 hours, and total RNA was extracted for reverse transcription and Q -PCR analysis, and a normal control group (wt, transfected with si-Control) was set up in the experiment.

[0113] Specific steps are as follows:

[0114] 1) RT-PCR: Total RNA was extracted according to the instructions of Beijing Tiangen Biochemical Technology Co., Ltd. total RNA extraction kit, the quality of RNA was identified by electrophoresis, and quantified by ultraviolet spectrophotometer. Take 1 μg of total RNA, configure 20 μL of a fluorescence quantitative reaction system according to the instructions of the full-type gold TransStart One-SteptcDNA SynthesisSuperMix, and perform reverse transcr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses small interfering RNA of long-chain non-coding RNALncRNA-COX2, application of the small interfering RNA in a drug for treating, diagnosing and prognostically evaluating tuberculosis, and application of the small interfering RNA of RNALncRNA-COX2 in preparation of a drug for preventing and treating tuberculosis. The LncRNA-COX2 is highly expressed in macrophage RAW264.7 cells infected with BCG, the LncRNA-COX2 has the function of being capable of inhibiting apoptosis of the macrophage, and therefore the small interfering RNA of LncRNA-COX2 can serve as a novel drug action target spot and has important significance on prevention and treatment of tuberculosis.

Description

technical field [0001] The invention relates to the field of biotechnology and medicine, in particular to the preparation and application of a long-chain non-coding RNA LncRNA-COX2 and its small interfering RNA and the application of related products. Background technique [0002] Tuberculosis (TB) is a zoonotic respiratory infectious disease caused by Mycobacterium tuberculosis infection and is the second leading cause of death in the world. Especially in recent years, the co-infection of Mycobacterium tuberculosis with human immunodeficiency virus (HIV) and type II diabetes has led to the emergence of multidrug-resistant strains, making the situation of tuberculosis increasingly severe. Alveolar macrophages are the main host cells and target cells of Mycobacterium tuberculosis. The innate immune response mediated by them is the first line of defense against Mycobacterium tuberculosis and plays a key role in Mycobacterium tuberculosis infection. It can be seen that the hos...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/88A61K31/713A61P31/06C12Q1/6883C12N15/11
CPCC12N15/113C12N15/88A61P31/06C12Q1/6883C12N2310/113C12Q2600/158C12Q2600/178
Inventor 邓光存马臣杰徐雅楠
Owner NINGXIA UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com