Preparation and application of LncRNA-COX2 small interfering RNA
A technology of RNA interference and small interference, applied in the field of biotechnology and medicine, can solve the problems of unexplained core mechanism and complex pathogenic mechanism of tuberculosis, and achieve the effect of promoting apoptosis and broad application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0073] Example 1: Changes in the expression of LncRNA-COX2 after BCG infection of RAW264.7 cells
[0074] BCG was respectively infected (MOI 1:10) cells for 0h, 6h, 12h, 18h, and 24h to collect the cells, extract the total RNA of RAW264.7 cells, reverse transcribe and perform Q-PCR analysis, and set up normal controls (wt, Wild RAW264.7 cells) group.
[0075] Specific steps are as follows:
[0076] 1) RT-PCR: The total RNA of RAW264.7 cells was extracted according to the operation steps of the total RNA extraction kit manual of Beijing Tiangen Biochemical Technology Co., Ltd., the quality of RNA was identified by electrophoresis, and quantified by ultraviolet spectrophotometer. Take 1 μg of total RNA, configure 20 μL of a fluorescence quantitative reaction system according to the instructions of the full-type gold TransStart One-Step cDNA Synthesis SuperMix, and perform reverse transcription according to the instructions of the instructions.
[0077] 2) Q-PCR: Select 1 μL of...
Embodiment 2
[0085] Example 2: Expression position of LncRNA-COX2 after BCG infection of RAW264.7 cells
[0086] After BCG infected macrophage RAW264.7 cells for 12 hours, FISH probe detection technology was used to locate LncRNA-COX2 and determine the expression position of LncRNA-COX2.
[0087] The nucleic acid sequence in the FISH probe is the following sequence; the fluorescent molecule is DAPI, which is connected to the 5' end of the sequence.
[0088] 5'aaagccggctttttcacaac3'
[0089] 5'aaatgctctcctacttgcca3'
[0090] 5'gaaaagtttccaggaaggga3'
[0091] Specific steps are as follows:
[0092] FISH probe detection:
[0093] (1) One day before infection, 5×10 per well 5 The cells were seeded in a six-well plate, and 2 mL of DEME medium containing 10% FBS was added to each well, and the 2 cultured in an incubator.
[0094] (2) Change the medium before infection, 2 mL of DMEM medium containing 10% FBS in each well of a 6-well plate, and infect with BCG (MOI 1:10).
[0095] (3) Aspira...
Embodiment 3
[0111] Example 3: Analysis of the expression level of LncRNA-COX2 after small interfering RNA interference of LncRNA-COX2
[0112] LncRNA-COX2 small interfering RNA siRNA-COX2-1 and siRNA-COX2-2 were transiently transfected into mouse macrophages 24 hours after BCG infection, and the cells were harvested at 48 hours, and total RNA was extracted for reverse transcription and Q -PCR analysis, and a normal control group (wt, transfected with si-Control) was set up in the experiment.
[0113] Specific steps are as follows:
[0114] 1) RT-PCR: Total RNA was extracted according to the instructions of Beijing Tiangen Biochemical Technology Co., Ltd. total RNA extraction kit, the quality of RNA was identified by electrophoresis, and quantified by ultraviolet spectrophotometer. Take 1 μg of total RNA, configure 20 μL of a fluorescence quantitative reaction system according to the instructions of the full-type gold TransStart One-SteptcDNA SynthesisSuperMix, and perform reverse transcr...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



