Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Shrna for inhibiting the replication of African swine fever virus and its use

An African swine fever virus, virus technology, applied in the direction of DNA/RNA fragments, viruses, antiviral agents, etc., can solve the problems of inability to induce protective immunity, limited effect, etc., achieve good inhibition, inhibit replication, and increase specific infection Effect

Active Publication Date: 2020-10-27
苏州沃美生物有限公司
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

ASFV vaccines prepared by traditional methods, such as purified and inactivated virus, formaldehyde-inactivated porcine alveolar macrophages infected with the virus, and supernatants of peripheral blood leukocytes from infected pigs failed to induce protective immunity
[0009] In general, both cellular and humoral immunity are very limited in the control of African swine fever infection and virus clearance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Shrna for inhibiting the replication of African swine fever virus and its use
  • Shrna for inhibiting the replication of African swine fever virus and its use
  • Shrna for inhibiting the replication of African swine fever virus and its use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach

[0047] In view of the deficiencies in the prior art, the inventors of the present invention have been able to propose the technical scheme of the present invention through long-term research and extensive practice, which can be summarized as follows: designing shRNA against African swine fever virus, and then using AAV virus as a carrier to construct Recombinant AAV expressing specific shRNA. Preferably, the recombinant AAV is modified for its Cap structural protein, that is, the optimized porcine macrophage C-reactive protein is added to the 3' end of the Cap gene, without affecting the assembly and stability of AAV , the modified AAV virus can bind to the C-reactive protein receptor of porcine macrophages, so that the recombinant AAV can specifically infect target cells, namely porcine macrophages.

[0048] The shRNAs described in the present invention consist of two complementary (sense and antisense) 19-29 base pair sequences separated by a short stem-loop (loop) of 4-11 d...

Embodiment 1

[0053] Example 1 Design and Construction of shRNA Sequences

[0054] 1. Design DNA sequences capable of transcribing shRNA for the A104R gene and I215L gene of African swine fever virus respectively. The DNA sequences are as follows:

[0055] A104R sense strand (SEQ ID NO.3):

[0056] cgcaagagctttactccttagtagcggcagttcaagagactgccgctactaaggagtaaagctcttgctttttta

[0057] A104R antisense strand (SEQ ID NO.4):

[0058] agcttaaaaaagcaagagctttactccttagtagcggcagtctcttgaactgccgctactaaggagtaaagctcttgcggtac

[0059] The above-mentioned sense strand and antisense strand templates include cohesive ends and shRNA sequences, and the sequences of the shRNAs are:

[0060] 5'-gcaagagctttactccttagtagcggcagttcaagagactgccgctactaaggagtaaagctcttgctttttt-3' (SEQ ID NO. 1),

[0061] Among them, uucaagaga is a loop structure, and the enzyme cutting site is Kpn1 (ggtacc).

[0062] I215L sense strand (SEQ ID NO.5):

[0063] cgacacctgatagagaatccctctgagaatttcaagagaattctcagaggggattctctatcaggtgtctttttt...

Embodiment 2

[0072] Example 2 Construction of pAAV-U6-A104R-shRNA plasmid and pAAV-U6-I215L-shRNA plasmid

[0073] Nanjing GenScript synthesized the U6 promoter gene (SEQ ID NO.7) and constructed the pAAV-U6 vector. The specific operations are as follows:

[0074] The pAAV-CAG vector (purchased from Addgene) was transformed, and the pAAV-CAG vector was cut with Nde1 / Kpn1 to remove the CAG promoter, and then the synthetic U6 promoter was connected to the double-digested pAAV-CAG vector, and the The CAG promoter replaced the U6 promoter in adult cells, resulting in pAAV-U6.

[0075] The vector pAAV-U6 was double digested with KpnI and HindIII to recover the target vector.

[0076] 1. The pAAV-U6 plasmid was digested with KpnⅠ and HindⅢ respectively at 37°C for 3 hours. The specific enzyme digestion reaction system is shown in Table 2.

[0077] The digested product was subjected to gel electrophoresis, and the digested pAAV-U6 plasmid was purified using a gel recovery purification kit.

[...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
diameteraaaaaaaaaa
diameteraaaaaaaaaa
Login to View More

Abstract

The present invention discloses a class of shRNAs used for inhibiting replication of African swine fever viruses. The shRNAs contain two shRNA sequences such as SEQ ID NO.1 and SEQ ID NO.2. The present invention also provides a use of the aforementioned shRNAs in inhibiting the replication of the African swine fever viruses. The present invention also provides a recombinant expression vector containing the aforementioned shRNAs, and an adeno-associated virus (AAV) and a preparation method thereof. The provided shRNAs and recombinant AAV can be used to prepare drugs for preventing and / or treating African swine fever virus infection, such as therapeutic vaccines and can also effectively inhibit the replication and infection of the African swine fever viruses, and the preparation process is simple and conducive to large-scale production and promotion and application.

Description

technical field [0001] The present invention relates to a kind of shRNA (short hairpin RNA), in particular to a kind of shRNA for inhibiting the replication of African swine fever virus and its application, such as the application in preparing African swine fever virus vaccine, which belongs to the technical field of bioengineering. Background technique [0002] RNA interference (RNA interference, RNAi) refers to the phenomenon that double-stranded RNA molecules (dsRNA) enter human cells and specifically degrade their homologous mRNAs, thereby specifically and efficiently inhibiting the expression of corresponding genes (Waterhouse, P.M., Wang, M.B. , Lough, T., (2001). Gene silencing as an adaptive defense against viruses. Nature 411:834–842.). When a homologous dsRNA with the coding region of endogenous mRNA is introduced into cells, the mRNA will be degraded and gene expression will be silenced, which is a special post-transcriptional gene silence (PTGS). Therapeutically...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/864A61K31/713A61P31/20
CPCA61P31/20C12N15/1131C12N15/86C12N2310/14C12N2320/32C12N2750/14143C12N2750/14152C12N2800/107C12N2310/531
Inventor 曹文龙孔迪孙祥明滕小锘张大鹤易小萍
Owner 苏州沃美生物有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com