Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Blocking ELISA detection method based on PEDV N protein specific nano-antibody and application thereof

A nano-antibody and detection method technology, applied in the field of immune engineering, can solve the problems of expensive, unstable, low specificity, etc., and achieve the effects of easy large-scale promotion, good application prospects, and good repeatability

Inactive Publication Date: 2019-07-16
NORTHWEST A & F UNIV
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these traditional methods are time-consuming, expensive, low specificity and low sensitivity and require professional equipment and professional operators
In addition, cross-contamination between samples and transportation delays may cause inaccurate results and other problems
Indirect ELISA and competitive or blocking ELISA have been widely used in the detection of PEDV clinical samples, but these methods are based on PEDV-specific monoclonal or polyclonal antibodies, which are costly, time-consuming, low-yield and Instability and other disadvantages

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Blocking ELISA detection method based on PEDV N protein specific nano-antibody and application thereof
  • Blocking ELISA detection method based on PEDV N protein specific nano-antibody and application thereof
  • Blocking ELISA detection method based on PEDV N protein specific nano-antibody and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Example 1 Construction of prokaryotic expression vector pET21b-Nb2-Avi-Tag

[0047] (1) Amplify the Nb2-Avi-Tag gene

[0048] Primers were designed according to the gene sequence (SEQ ID NO.1) of Nb2 in the "pCANTAB-5E-Nb2" plasmid preserved in our laboratory, and BamH I and Hind III restriction endonuclease sites were introduced at the 5' ends of the upstream and downstream primers, respectively. , marked by an underscore;

[0049] The primer sequences are as follows:

[0050] pET21b-Nb2-F:CG GGATCC GCAGGTCCAACTGCAGGAG; SEQ ID NO. 2;

[0051] pET21b-Nb2-R: CCC AAGCTT TTCGTGCCATTCGATTTTCTGAGCTTCGAAATATCGTTCAGACCTGAGGAGACGGTGACCTGGGTCC; SEQ ID NO. 3; Avi-Tag sequence is marked in italics.

[0052] Using the pCANTAB-5E-Nb2 plasmid as a template to amplify the Nb2-Avi-Tag gene, the reaction system is as follows:

[0053]

[0054] Reaction program: pre-denaturation at 94°C for 3 minutes; 28 cycles of 94°C for 15s, 55°C for 5s, and 72°C for 45s; extension at 72°C f...

Embodiment 2

[0071] Example 2 Expression, Solubility Identification, Biotin Labeling and Specificity Verification of pET21b-Nb2-Avi-Tag in Escherichia coli

[0072] Transform the correctly sequenced pET21b-Nb2-Avi-Tag plasmid into BL21(DE3) expression-competent cells, and operate according to the competent instructions; then take 200 μl of the bacteria and spread it on the LB / AMP plate, and place it in a constant temperature culture at 37°C Incubate overnight in the box. The same operation was carried out to transform pET21b empty vector.

[0073] Pick single clones with round shapes (pET21b-Nb2-Avi-Tag plasmid and pET21b empty vector plasmid respectively), inoculate them in 1ml LB / AMP medium, place them in a constant temperature shaker at 37°C at 200r / min for 8 -10h; 600 μl of the culture was taken out and 250 μl of sterile 50% glycerol was added, mixed well, and stored at -20°C, and the remaining culture was used for the next experiment.

[0074] Take the remaining 100μl of the above c...

Embodiment 3

[0081] Embodiment 3 is based on the establishment of BioNb2 blocking ELISA method

[0082] (1) Determination of the amount of coated antigen and BioNb2

[0083] According to the checkerboard method, the purified PEDV N protein prepared in the laboratory was diluted to 0.25 μg / mL, 0.5 μg / mL, 1 μg / mL, 2 μg / mL and 4 μg / mL respectively; Wash the plate 3 times with PBS'T containing 0.5% Tween-20; add 200 μl PBS'T (blocking solution) containing 2.5% skimmed milk powder to each well, wash the plate 3 times with PBS'T; : 500, 1: 1000, 1: 2000, 1: 4000, 1: 6000 and 1: 8000 diluted Nanobody BioNb2 was incubated for 1 h, washed 3 times in PBS'T; After dilution at 2000, incubate at 25°C for 1 hour, wash with PBS'T for 3 times; add fresh TMB substrate solution, 100 μl / well, incubate at 25°C in the dark for 15 minutes, add stop solution 50 μl 3M H 2 SO 4 Stop the reaction and read the OD in a microplate reader 450 value. The results are shown in Table 1, the coated antigen was diluted ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a blocking ELISA detection method based on PEDV N protein specific nano-antibody and an application thereof. PEDV N proteins are used to coat ELISA plates, the nano-antibody BioNb2 is used as a blocking antibody, and serum samples to be tested are used to inhibit binding of the nano-antibody BioNb2 and PEDV N proteins to detect porcine epidemic diarrhea virus-specific antibody in the serum. The blocking ELISA method is capable of excluding interference of miscellaneous protein components in antigen, has good specificity, is also simple to operate and easy for wide promotion, and has a good application prospect in serodiagnosis of porcine epidemic diarrhea viruses. A large amount of experiments optimize reaction conditions of the blocking ELISA, so that the method used for detection of the porcine epidemic diarrhea virus antibody has good repeatability, specificity and sensitivity, and has advantages of being simple, rapid, low in costs, etc. compared with currently available commercial kits.

Description

technical field [0001] The invention relates to the technical field of immune engineering, in particular to a detection method of blocking ELISA based on PEDV N protein-specific nanobody and its application. Background technique [0002] Porcine epidemic diarrhea (Porcine epidemic diarrhea, PED) is caused by porcine epidemic diarrhea virus (Porcine epidemic diarrhea virus, PEDV). Diarrhea, vomiting, dehydration, little or no food, and the mortality rate of suckling piglets was 100%. The disease is one of the most serious diseases that endanger the breeding industry at present, and brings huge economic losses to the global pig industry every year. PEDV can infect pigs of all ages. Adult pigs mainly show weight loss and malnutrition, but it is fatal to suckling piglets within one week of age. The disease first occurred in England in 1791 and became endemic in Europe. In my country, the virus was first detected in pigs in Shanghai in 1973, and then it occurred in a sporadic ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K16/10C12N15/13C12N15/70G01N33/569
CPCC07K16/10C07K2317/569G01N33/56983
Inventor 肖书奇马志倩王天宇田阳升李爽
Owner NORTHWEST A & F UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com