Blocking ELISA detection method based on PEDV N protein specific nano-antibody and application thereof
A nano-antibody and detection method technology, applied in the field of immune engineering, can solve the problems of expensive, unstable, low specificity, etc., and achieve the effects of easy large-scale promotion, good application prospects, and good repeatability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] Example 1 Construction of prokaryotic expression vector pET21b-Nb2-Avi-Tag
[0047] (1) Amplify the Nb2-Avi-Tag gene
[0048] Primers were designed according to the gene sequence (SEQ ID NO.1) of Nb2 in the "pCANTAB-5E-Nb2" plasmid preserved in our laboratory, and BamH I and Hind III restriction endonuclease sites were introduced at the 5' ends of the upstream and downstream primers, respectively. , marked by an underscore;
[0049] The primer sequences are as follows:
[0050] pET21b-Nb2-F:CG GGATCC GCAGGTCCAACTGCAGGAG; SEQ ID NO. 2;
[0051] pET21b-Nb2-R: CCC AAGCTT TTCGTGCCATTCGATTTTCTGAGCTTCGAAATATCGTTCAGACCTGAGGAGACGGTGACCTGGGTCC; SEQ ID NO. 3; Avi-Tag sequence is marked in italics.
[0052] Using the pCANTAB-5E-Nb2 plasmid as a template to amplify the Nb2-Avi-Tag gene, the reaction system is as follows:
[0053]
[0054] Reaction program: pre-denaturation at 94°C for 3 minutes; 28 cycles of 94°C for 15s, 55°C for 5s, and 72°C for 45s; extension at 72°C f...
Embodiment 2
[0071] Example 2 Expression, Solubility Identification, Biotin Labeling and Specificity Verification of pET21b-Nb2-Avi-Tag in Escherichia coli
[0072] Transform the correctly sequenced pET21b-Nb2-Avi-Tag plasmid into BL21(DE3) expression-competent cells, and operate according to the competent instructions; then take 200 μl of the bacteria and spread it on the LB / AMP plate, and place it in a constant temperature culture at 37°C Incubate overnight in the box. The same operation was carried out to transform pET21b empty vector.
[0073] Pick single clones with round shapes (pET21b-Nb2-Avi-Tag plasmid and pET21b empty vector plasmid respectively), inoculate them in 1ml LB / AMP medium, place them in a constant temperature shaker at 37°C at 200r / min for 8 -10h; 600 μl of the culture was taken out and 250 μl of sterile 50% glycerol was added, mixed well, and stored at -20°C, and the remaining culture was used for the next experiment.
[0074] Take the remaining 100μl of the above c...
Embodiment 3
[0081] Embodiment 3 is based on the establishment of BioNb2 blocking ELISA method
[0082] (1) Determination of the amount of coated antigen and BioNb2
[0083] According to the checkerboard method, the purified PEDV N protein prepared in the laboratory was diluted to 0.25 μg / mL, 0.5 μg / mL, 1 μg / mL, 2 μg / mL and 4 μg / mL respectively; Wash the plate 3 times with PBS'T containing 0.5% Tween-20; add 200 μl PBS'T (blocking solution) containing 2.5% skimmed milk powder to each well, wash the plate 3 times with PBS'T; : 500, 1: 1000, 1: 2000, 1: 4000, 1: 6000 and 1: 8000 diluted Nanobody BioNb2 was incubated for 1 h, washed 3 times in PBS'T; After dilution at 2000, incubate at 25°C for 1 hour, wash with PBS'T for 3 times; add fresh TMB substrate solution, 100 μl / well, incubate at 25°C in the dark for 15 minutes, add stop solution 50 μl 3M H 2 SO 4 Stop the reaction and read the OD in a microplate reader 450 value. The results are shown in Table 1, the coated antigen was diluted ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


