Blocking ELISA detection method based on PEDV N protein specific nano-antibody and application thereof
A nano-antibody and detection method technology, applied in the field of immune engineering, can solve the problems of expensive, unstable, low specificity, etc., and achieve the effects of easy large-scale promotion, good application prospects, and good repeatability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] Example 1 Construction of prokaryotic expression vector pET21b-Nb2-Avi-Tag
[0047] (1) Amplify the Nb2-Avi-Tag gene
[0048] Primers were designed according to the gene sequence (SEQ ID NO.1) of Nb2 in the "pCANTAB-5E-Nb2" plasmid preserved in our laboratory, and BamH I and Hind III restriction endonuclease sites were introduced at the 5' ends of the upstream and downstream primers, respectively. , marked by an underscore;
[0049] The primer sequences are as follows:
[0050] pET21b-Nb2-F:CG GGATCC GCAGGTCCAACTGCAGGAG; SEQ ID NO. 2;
[0051] pET21b-Nb2-R: CCC AAGCTT TTCGTGCCATTCGATTTTCTGAGCTTCGAAATATCGTTCAGACCTGAGGAGACGGTGACCTGGGTCC; SEQ ID NO. 3; Avi-Tag sequence is marked in italics.
[0052] Using the pCANTAB-5E-Nb2 plasmid as a template to amplify the Nb2-Avi-Tag gene, the reaction system is as follows:
[0053]
[0054] Reaction program: pre-denaturation at 94°C for 3 minutes; 28 cycles of 94°C for 15s, 55°C for 5s, and 72°C for 45s; extension at 72°C f...
Embodiment 2
[0071] Example 2 Expression, Solubility Identification, Biotin Labeling and Specificity Verification of pET21b-Nb2-Avi-Tag in Escherichia coli
[0072] Transform the correctly sequenced pET21b-Nb2-Avi-Tag plasmid into BL21(DE3) expression-competent cells, and operate according to the competent instructions; then take 200 μl of the bacteria and spread it on the LB / AMP plate, and place it in a constant temperature culture at 37°C Incubate overnight in the box. The same operation was carried out to transform pET21b empty vector.
[0073] Pick single clones with round shapes (pET21b-Nb2-Avi-Tag plasmid and pET21b empty vector plasmid respectively), inoculate them in 1ml LB / AMP medium, place them in a constant temperature shaker at 37°C at 200r / min for 8 -10h; 600 μl of the culture was taken out and 250 μl of sterile 50% glycerol was added, mixed well, and stored at -20°C, and the remaining culture was used for the next experiment.
[0074] Take the remaining 100μl of the above c...
Embodiment 3
[0081] Embodiment 3 is based on the establishment of BioNb2 blocking ELISA method
[0082] (1) Determination of the amount of coated antigen and BioNb2
[0083] According to the checkerboard method, the purified PEDV N protein prepared in the laboratory was diluted to 0.25 μg / mL, 0.5 μg / mL, 1 μg / mL, 2 μg / mL and 4 μg / mL respectively; Wash the plate 3 times with PBS'T containing 0.5% Tween-20; add 200 μl PBS'T (blocking solution) containing 2.5% skimmed milk powder to each well, wash the plate 3 times with PBS'T; : 500, 1: 1000, 1: 2000, 1: 4000, 1: 6000 and 1: 8000 diluted Nanobody BioNb2 was incubated for 1 h, washed 3 times in PBS'T; After dilution at 2000, incubate at 25°C for 1 hour, wash with PBS'T for 3 times; add fresh TMB substrate solution, 100 μl / well, incubate at 25°C in the dark for 15 minutes, add stop solution 50 μl 3M H 2 SO 4 Stop the reaction and read the OD in a microplate reader 450 value. The results are shown in Table 1, the coated antigen was diluted ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com