Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for promoting stem cell proliferation by inducing expression of Sympk scaffolding protein and application thereof

A scaffold protein, inducible expression technology, applied in the field of biomedicine, can solve problems such as undiscovered Sympk protein

Inactive Publication Date: 2019-07-19
SUN YAT SEN UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, no relevant reports have been found on the role of Sympk protein in promoting cell proliferation.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for promoting stem cell proliferation by inducing expression of Sympk scaffolding protein and application thereof
  • Method for promoting stem cell proliferation by inducing expression of Sympk scaffolding protein and application thereof
  • Method for promoting stem cell proliferation by inducing expression of Sympk scaffolding protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0074] 1. Construction of cells expressing Sympk scaffold protein

[0075] 1) Using CD1 mouse testis cDNA as a template, carry out PCR amplification through specific primers to obtain the full-length Sympk sequence, wherein the specific primer sequences are as follows:

[0076] FP: CATGCGATATCATGGCAAGCAGCAGCGGGGACAGT (SEQ ID NO. 1),

[0077]RP: TGCTCGAAGCGGCCGCTCAGCTGTTCCCCTTGCTCTCGGGTT (SEQ ID NO. 2);

[0078] 2) Link the full-length sequence of Sympk into 3×Flag-p2lox through the restriction site EcoRV / NotI;

[0079] 3) Transfect plasmids 1.3 μg 3×Flag-P2loxp-Sympk and 1.3 μg pSolk-Cre into A17 cells with 7.8 μl lipo2000 transfection reagent;

[0080] 4) G418 screening for 10 days, select clones, detect Sympk exogenous expression, and finally determine the clones with higher expression (marked as No.1 and No.2 in the embodiment of the present invention) No.1 and No.2 for subsequent follow-up Research.

[0081] Add doxycycline at concentrations of 0ng / ml, 100ng / ml, 500ng / ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for culturing stem cells and an application thereof, and also provides a method for promoting stem cell proliferation by inducing expression of Sympk scaffolding protein and an application thereof. The method for culturing the stem cells comprises: 1) cloning a gene coding sequence of Sympk into an expression vector to obtain a recombinant expression vector; 2) transfecting the recombinant expression vector into cells to obtain cells by inducible expression of the Sympk scaffolding protein; 3) inducing the expression of the Sympk scaffolding protein; and 4) subcultring to obtain the stem cells. The Sympk scaffolding protein provided by the present invention is a conserved protein widely existed in higher organisms, can promote the proliferation of the stem cells by inducing the expression of Sympk scaffold protein during cell culture in vitro, does not affect its differentiation potential, and does not form embryo cancer cells.

Description

technical field [0001] The invention relates to the field of biomedicine, in particular to a method and application of an inducible-expressed Sympk scaffold protein, which promotes the proliferation of stem cells and maintains self-renewal and pluripotency. Background technique [0002] Stem cells are a type of pluripotent cells with self-replicating ability. Under certain conditions, it can differentiate into a variety of functional cells. Embryonic stem cells, with their extensive self-renewal capacity and pluripotent potential to differentiate into cells of all three germ layers, are useful for therapeutic purposes and provide an unlimited source of cells for tissue transplantation therapy, drug screening, functional genomics, and proteomics . [0003] Stem cell transplantation is an advanced medical technology that brings hope to the treatment of some intractable diseases. Stem cell transplantation is a medical method that transplants healthy stem cells into the patie...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/0735C07K14/47C12N15/12C12N15/63
CPCC12N5/0606C07K14/47
Inventor 黄军就俞建萍马文宾
Owner SUN YAT SEN UNIV