Probe for identifying central centromere chromosomes of patinopecten yessoensis and preparation method thereof

A technology for shrimp scallops and chromosomes, which is applied in the field of shellfish chromosome research to achieve the effects of easy differentiation and obvious signals

Active Publication Date: 2019-07-26
OCEAN UNIV OF CHINA
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, at present, Ezo scallop lacks corresponding markers as probes to efficiently and quickly identify chromosomes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Probe for identifying central centromere chromosomes of patinopecten yessoensis and preparation method thereof
  • Probe for identifying central centromere chromosomes of patinopecten yessoensis and preparation method thereof
  • Probe for identifying central centromere chromosomes of patinopecten yessoensis and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Embodiment 1: the preparation of probe

[0030] 1) Fosmid monoclonal screening: According to the integration of the SNP linkage map and the chromosome map of Scallop edulis, the three SNP markers screened by the three linkage groups LG6, LG9 and LG19 correspond to the middle centromere chromosome of scalloped scallop.

[0031] SNP marker M8173 identifying the first pair of middle centromere chromosomes, the nucleotide sequence of which is CAGACAGGGAGCTATAGTTTGTACTTA (SEQ ID NO: 1);

[0032] The SNP marker M7337 identifying the second pair of middle centromere chromosomes has a nucleotide sequence of TTTCAATTTACTTAAACTCCCTGTTAT (SEQ ID NO: 2);

[0033] SNP marker M687 identifying the third pair of middle centromere chromosomes, the nucleotide sequence of which is TTATTCTATACGAGGACTCCAGCTTTT (SEQ ID NO: 3);

[0034] The above-mentioned SNP markers were used to prepare probes for mapping the three pairs of mesocentromere chromosomes of Scallop scallops.

[0035] First, u...

Embodiment 2

[0041] Example 2: Mapping Chromosomes Using Probes

[0042]1) Chromosome preparation: use a 500-mesh sieve to collect trochophore larvae, use 0.01% colchicine for 2.5 hours to fix the larvae, then use 0.075M KCL to perform hypotonic treatment on the larval material for 30 minutes, and then The material is placed in freshly prepared Carnot's reagent, and the Carnot's reagent is replaced three times. Here, the material can be stored at -20°C for a long time, and then dissociated with freshly prepared 50% acetic acid for 5-10 minutes. The hot drop method was used to prepare the slides, the chromosome materials were fixed on the glass slides, and placed in an oven at 60°C for 2-3 hours to make the chromosome materials closely adhere to the slides and prevent the chromosome materials from falling off during the hybridization process. References for chromosome preparation (Huang et al. al. 2007. Mapping of ribosomal DNA and (TTAGGG)n telomeric sequence by FISH in the bivalve Patinop...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a method for identifying central centromere chromosomes of patinopecten yessoensis. By combining genome sequence information, SNP linkage map information and fosmid monoclonal decoding information of patinopecten yessoensis, three labels distributed on a SNP linkage map of the patinopecten yessoensis are selected to screen a fosmid library, screened clones containing SNP sites are utilized to prepare probes with fluorescent labels, then fluorescent in-situ hybridization and co-hybridization are carried out by using the probes, and the specific recognition of the three pairs of central centromere chromosomes of the scallop according to the distribution of the fluorescent signals of the three specific clones containing the SNP labels on the scallop chromosomes. The three labels achieve identification of the three pairs of central centromere chromosomes and have important significance differentiation and identification of scallop yessoensis chromosomes, constructionof cytogenetic maps and evolution analysis among chromosomes from different species.

Description

technical field [0001] The invention belongs to the technical field of shellfish chromosome research, and in particular relates to a probe for identifying centromere chromosomes in the middle of the scallop and a preparation method thereof. Background technique [0002] Scallop (Jay, 1857) is a cold-water bivalve mollusk and an important aquaculture species with great scientific and economic value. There are 19 pairs of chromosomes in Scallop scallops, including four types of chromosomes: mesocentromere, submetacentromere, subtelocentromere and telocentromere. The results of karyotype analysis showed that the size of the homochromosomes of the scallop scallop was continuously distributed, and their shapes were relatively similar. It is unrealistic to realize the identification of chromosomes simply by karyotype analysis; and the identification of chromosomes is very important for promoting the study of scallop cytogenetics and Genetic breeding work is of great significance....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888
Inventor 黄晓婷杨祖晶包振民陆维胡丽萍李晅廖欢
Owner OCEAN UNIV OF CHINA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap