Saccharomyces cerevisiae engineering strain for achieving high yield of pyruvic acid and fermentation method of strain
A technology of Saccharomyces cerevisiae and Saccharomyces cerevisiae, which is applied in the field of Saccharomyces cerevisiae engineering strains and its fermentation, which can solve the problems of increasing the difficulty of fermentation control and fermentation cost, long fermentation cycle, and insufficient pyruvate production.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Example 1: Construction of △pdc1△pdc5△pdc6 three-gene-deficient strain
[0037] The construction of high-yield pyruvate Saccharomyces cerevisiae engineering strains comprises the following steps:
[0038] 1) Construction of △pdc6-deficient Saccharomyces cerevisiae engineering strain
[0039] The primers for Saccharomyces cerevisiae pdc6 gene knockout component were designed as follows:
[0040] upstream primer
[0041] GAATTGATCTGTATCTGCACCTAGATCGATTTGATTACAGTTCGTACGCTGCAGGTCGA
[0042] downstream primer
[0043] GTAACATGCGAATTGCGTAATTCACGGCGATAACGTAGGCATAGGCCACTAGTGGAT CT
[0044] Utilizing the upstream and downstream primers, using the plasmid pUG6 as a template, PCR amplified to obtain a knockout component fragment containing the upstream and downstream homology arms of the pdc6 open reading frame (ORF) and the resistance selection marker gene KamX, and the above-mentioned The knockout component fragments were respectively introduced into XY-49-MATa and XY-49-MA...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


