Check patentability & draft patents in minutes with Patsnap Eureka AI!

Saccharomyces cerevisiae engineering strain for achieving high yield of pyruvic acid and fermentation method of strain

A technology of Saccharomyces cerevisiae and Saccharomyces cerevisiae, which is applied in the field of Saccharomyces cerevisiae engineering strains and its fermentation, which can solve the problems of increasing the difficulty of fermentation control and fermentation cost, long fermentation cycle, and insufficient pyruvate production.

Active Publication Date: 2019-08-09
GUANGXI ACAD OF SCI
View PDF13 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For example, most of the starting Saccharomyces cerevisiae strains used in the literature reports are auxotrophic. In the process of using synthetic medium for fermentation, additional nutrients such as essential amino acids need to be added, which increases the difficulty of fermentation control and fermentation costs; In addition, the obtained Engineering strains still have problems such as insufficient pyruvate production and too long fermentation cycle

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Saccharomyces cerevisiae engineering strain for achieving high yield of pyruvic acid and fermentation method of strain
  • Saccharomyces cerevisiae engineering strain for achieving high yield of pyruvic acid and fermentation method of strain
  • Saccharomyces cerevisiae engineering strain for achieving high yield of pyruvic acid and fermentation method of strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1: Construction of △pdc1△pdc5△pdc6 three-gene-deficient strain

[0037] The construction of high-yield pyruvate Saccharomyces cerevisiae engineering strains comprises the following steps:

[0038] 1) Construction of △pdc6-deficient Saccharomyces cerevisiae engineering strain

[0039] The primers for Saccharomyces cerevisiae pdc6 gene knockout component were designed as follows:

[0040] upstream primer

[0041] GAATTGATCTGTATCTGCACCTAGATCGATTTGATTACAGTTCGTACGCTGCAGGTCGA

[0042] downstream primer

[0043] GTAACATGCGAATTGCGTAATTCACGGCGATAACGTAGGCATAGGCCACTAGTGGAT CT

[0044] Utilizing the upstream and downstream primers, using the plasmid pUG6 as a template, PCR amplified to obtain a knockout component fragment containing the upstream and downstream homology arms of the pdc6 open reading frame (ORF) and the resistance selection marker gene KamX, and the above-mentioned The knockout component fragments were respectively introduced into XY-49-MATa and XY-49-MA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a saccharomyces cerevisiae genetic engineering strain for achieving high yield of pyruvic acid. The strain is classified and named as saccharomyces cerevisiae XY-156A and preserved in the China General Microbiological Culture Collection Center, and the preservation number of the strain is CCTCC M 2019129. The saccharomyces cerevisiae genetic engineering strain XY-156A can utilize a large amount of glucose for fermentation production of the pyruvic acid, fed-batch fermentation is conducted for 76 hours, the concentration of the pyruvic acid in fermentation liquid can reach 105 g / L, for the yield of the pyruvic acid, 0.5 gram of the pyruvic acid is obtained through per gram of the glucose, and the strain has potential application value in fermentation production of the pyruvic acid.

Description

technical field [0001] The invention relates to a high-pyruvate-producing Saccharomyces cerevisiae engineering strain and a fermentation method thereof, belonging to the technical field of fermentation engineering. Background technique [0002] Pyruvic acid (pyruvic acid), a light yellow to yellow transparent liquid, widely exists in the human body, animals, plants and microorganisms, and is an important intermediate product in the process of cell metabolism; pyruvic acid and its salts serve as an important platform Compounds are widely used in chemical, pharmaceutical, agricultural chemicals, food health care and other fields. For example, pyruvic acid and its salts are precursors for the synthesis of important compounds such as L-tyrosine, L-tryptophan, vitamin B6, N-acetyl-D-neuraminic acid, (R)-acetylbenzyl alcohol; In addition, it has potential applications in human health care such as anti-fatigue, increasing endurance, lowering blood fat, and losing weight. [0003]...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/19C12N15/81C12N1/36C12P7/40C12R1/865
CPCC12N9/88C12Y401/01001C12N15/81C12N1/36C12P7/40Y02E50/10
Inventor 李亿王青艳秦艳朱婧梁戈彭龙云潘丽霞
Owner GUANGXI ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More