Technology using short capillary tube high-speed electrophoresis to detect miRNA in lung cancer cells

A lung cancer cell and capillary technology, applied in the field of molecular biology, can solve the problems of patients who are difficult to accept repeated treatment, less adverse reactions, difficult treatment, etc., and achieve the effect of low cost, high sensitivity and convenient detection

Active Publication Date: 2019-09-20
FUZHOU UNIV
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, advanced gene sequencing technology can be used to carry out molecular typing of different histopathological types of lung cancer, and targeted drugs can be selected at the molecular level, which are highly targeted, have fewer adverse reactions, and are better tolerated. Treatment is also becoming more difficult
Some targeted drugs such as gefitinib, erlotinib, and icotinib are EGFR-TKIs commonly used in clinical practice, and they are all approved by the State Food and Drug Administration for the first-line treatment of patients with EGFR-mutated advanced NSCLC. In clinical work, it is often impossible to obtain the EGFR molecular typing of NSCLC patients due to various reasons. At present, for patients with EGFR mutation-negative or unknown NSCLC patients, platinum-based double-drug regimens are still the first-line treatment, but chemotherapy resistance often occurs, and with the The anti-cancer process continues, adverse reactions to chemotherapy, recurrence, complications and other reasons make it difficult for these patients to receive repeated treatment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Technology using short capillary tube high-speed electrophoresis to detect miRNA in lung cancer cells
  • Technology using short capillary tube high-speed electrophoresis to detect miRNA in lung cancer cells
  • Technology using short capillary tube high-speed electrophoresis to detect miRNA in lung cancer cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] 1. Sample preparation

[0027] Treat the obtained A549 cells with trypsin, centrifuge, take the supernatant, wash, vortex, centrifuge, add 75% ethanol to wash the precipitate, and dissolve the dried RNA with RNase-free water for reaction.

[0028] 2. DNA fluorescent probe

[0029] Design two DNA single-strands H1 and H2 that can be complementary to miRNA-21 and miRNA-31, respectively, and connect FAM groups to H1 and H2 to make them have fluorescent signals. These two DNA single-strands are called H1 , H2 are DNA fluorescent probes for miRNA-21 and miRNA-31, the base sequence of the nucleic acid chain involved is as follows (sequence from 5' to 3'):

[0030] miRNA-21 UAGCUUAUCAGACUGAUGUUGA;

[0031] H1-21: ATCAGACTGATGTTGACAAAGTTCAACATCAGTCTGATAAGCTA-FAM;

[0032] H2-21: FAM-ACTTTGTCAACATCAGTCTGATTAGCTTATCAGACTGATGTTGA;

[0033] miRNA-31 AGGCAAGAUGCUGGCAUAGCU;

[0034] H1-31: FAM-GATGCTGGCATAGCTCAAAAGTAGCTATGCCAGCATCTTGCCT;

[0035] H2-31: ACTTTGAGCTATGCCAGCATCAGG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a simultaneous diagnosis method based on the miRNA detection technology and separation. The method uses an HCR method to perform hybridization chain reaction, enzyme participation is not needed, the method is different from other detection methods, and accordingly the method does not have strict requirements on temperature and other environment conditions; compared with detection technologies in the prior art, the miRNA detection technology does not need complex programs or complex and expensive instruments, detection convenience is achieved, the technology is simple and low in cost, fast detection is achieved by using LIF to perform detection, and the detection can be completed in 2 minutes; after miRNA have hybridization chain reaction with matched H1 and H2, and a long-chain duplex DNA structure during product formation is high in stability; the technology is extremely high in detection sensitivity, and miRNA-21 and miRNA-31 detection and separation can be completed by a small number of samples; the method is good in specificity and good in detection effect on cancer cell A549.

Description

technical field [0001] The invention belongs to the field of molecular biology, and in particular relates to a technique for detecting miRNA in lung cancer cells by short capillary high-speed electrophoresis. Background technique [0002] Small ribonucleic acid miRNA is a non-coding single-stranded RNA widely found in plants and animals. As post-transcriptional regulators, miRNAs affect protein levels and intracellular homeostasis through translational repression mechanisms. More and more evidence shows that the dysregulation of miRNAs in animals can stimulate the occurrence of cancer, therefore, the detection of miRNAs in organisms is of great significance, and among the increasing number of characterized miRNAs, miRNA-21 and miRNA-31 are in the Overexpression in multiple cancer cell lines has shown significant clinical relevance. [0003] Sensitive detection methods are a must for the detection of miRNAs, since they are present in low amounts in organisms. The most comm...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6886C12Q1/6816
CPCC12Q1/6816C12Q1/6886C12Q2600/158C12Q2600/178C12Q2525/207C12Q2525/301C12Q2565/125
Inventor 王伟蔡小玉
Owner FUZHOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products