A kit for identifying the degree of fatty liver in yellow catfish and its identification method
A technology of yellow catfish and fatty liver, which is applied in the field of kits for identifying the degree of fatty liver of yellow catfish, can solve the problem of lack of accurate identification of the degree of fatty liver of yellow catfish liver, and achieve no influence on growth and metabolism level, accurate Effects of treatment and expression enhancement
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] Two groups of feeds with different fat levels were prepared with isonitrogen and isoenergy, normal group (feed protein level 38%, fat level 5%) and high-fat group (feed protein level 38%, fat level 17%) (Table 1).
[0050] About 20 g of yellow catfish were selected to be fed to the above-mentioned two groups of experimental feeds, three groups were set in parallel for each treatment, and the breeding period was 60 days. Liver samples were taken at 20, 40 and 60 days after feeding. Nine fish were randomly selected from each treatment group, and liver tissue samples were quickly obtained by ice bath sampling, and the time for extracting each tissue sample was controlled within 30 s. qRT-PCR was used to identify the expression characteristics of miR-484 and its target genes in the normal group and high-fat stress group, and analyze their differences in expression.
[0051] Table 1 Feed components and nutrient levels
[0052]
[0053]
[0054] Table 2 miRNA and mRNA...
Embodiment 2
[0063] A kit for identifying the degree of fatty liver in yellow catfish, comprising: a miR-484-specific upstream primer whose nucleotide sequence is shown in SEQ ID NO.1, a universal reverse primer whose nucleotide sequence is shown in SEQ ID NO.2, 2 x SYBR Green MasterMix and distilled water.
Embodiment 3
[0065] 1. The miR-484 promoter was designed according to the sequence of the mature miR-484 (5'-TCAGGCTCAGTCCCCTCCCGAT-3' (SEQ ID NO. 9)). The single-stranded small RNA (UCAGGCUCAGUCCCCUCCCGAU) prepared by chemical synthesis and specially labeled and chemically modified can effectively enhance the expression of endogenous miR-484. At the same time, we modified the promoter with cholesterol at the 3' end, four sulfur backbone modifications at the 3' end, two sulfur backbone modifications at the 5' end, and full-chain 2' methylation modification, so that the miR-484 promoter can Effectively enter the body for specific binding and increase the inhibition efficiency of target genes.
[0066] 2. Add 25mg dry powder reagent of miR-484 promoter or negative promoter (5′-UUUGUACUACACAAAAAGUACUG-3′ (SEQID NO.8)) into 1.875ml PBS buffer for dilution, shake up and down, mix well, and let stand for 5min Afterwards, centrifuge at 5000rpm for 15s, and configure the working solution of miR-4...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



