Unlock instant, AI-driven research and patent intelligence for your innovation.

A kit for identifying the degree of fatty liver in yellow catfish and its identification method

A technology of yellow catfish and fatty liver, which is applied in the field of kits for identifying the degree of fatty liver of yellow catfish, can solve the problem of lack of accurate identification of the degree of fatty liver of yellow catfish liver, and achieve no influence on growth and metabolism level, accurate Effects of treatment and expression enhancement

Active Publication Date: 2022-07-29
FRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In order to overcome the existing defect of lack of accurate identification of the degree of fatty liver in the liver of yellow catfish, the present invention provides a kit for identifying the degree of fatty liver of yellow catfish and its identification method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kit for identifying the degree of fatty liver in yellow catfish and its identification method
  • A kit for identifying the degree of fatty liver in yellow catfish and its identification method
  • A kit for identifying the degree of fatty liver in yellow catfish and its identification method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Two groups of feeds with different fat levels were prepared with isonitrogen and isoenergy, normal group (feed protein level 38%, fat level 5%) and high-fat group (feed protein level 38%, fat level 17%) (Table 1).

[0050] About 20 g of yellow catfish were selected to be fed to the above-mentioned two groups of experimental feeds, three groups were set in parallel for each treatment, and the breeding period was 60 days. Liver samples were taken at 20, 40 and 60 days after feeding. Nine fish were randomly selected from each treatment group, and liver tissue samples were quickly obtained by ice bath sampling, and the time for extracting each tissue sample was controlled within 30 s. qRT-PCR was used to identify the expression characteristics of miR-484 and its target genes in the normal group and high-fat stress group, and analyze their differences in expression.

[0051] Table 1 Feed components and nutrient levels

[0052]

[0053]

[0054] Table 2 miRNA and mRNA...

Embodiment 2

[0063] A kit for identifying the degree of fatty liver in yellow catfish, comprising: a miR-484-specific upstream primer whose nucleotide sequence is shown in SEQ ID NO.1, a universal reverse primer whose nucleotide sequence is shown in SEQ ID NO.2, 2 x SYBR Green MasterMix and distilled water.

Embodiment 3

[0065] 1. The miR-484 promoter was designed according to the sequence of the mature miR-484 (5'-TCAGGCTCAGTCCCCTCCCGAT-3' (SEQ ID NO. 9)). The single-stranded small RNA (UCAGGCUCAGUCCCCUCCCGAU) prepared by chemical synthesis and specially labeled and chemically modified can effectively enhance the expression of endogenous miR-484. At the same time, we modified the promoter with cholesterol at the 3' end, four sulfur backbone modifications at the 3' end, two sulfur backbone modifications at the 5' end, and full-chain 2' methylation modification, so that the miR-484 promoter can Effectively enter the body for specific binding and increase the inhibition efficiency of target genes.

[0066] 2. Add 25mg dry powder reagent of miR-484 promoter or negative promoter (5′-UUUGUACUACACAAAAAGUACUG-3′ (SEQID NO.8)) into 1.875ml PBS buffer for dilution, shake up and down, mix well, and let stand for 5min Afterwards, centrifuge at 5000rpm for 15s, and configure the working solution of miR-4...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a kit for identifying the degree of fatty liver in yellow catfish and an identification method thereof, and relates to the technical field of aquatic organisms. The kit for identifying the degree of fatty liver in yellow catfish comprises miR-484-specific upstream primers and Universal reverse primer; the nucleotide sequence of the miR-484-specific upstream primer is shown in SEQ ID NO.1. The research of the present invention shows that the expression of miR-484 in yellow catfish is negatively correlated with the degree of fatty liver occurrence, and the miR-484-specific upstream primers and universal downstream primers provided by the present invention can quickly detect the miR-484 of yellow catfish. 484 expression, and then accurately determine the degree of fatty liver in yellow catfish, providing a basis for accurate drug delivery.

Description

technical field [0001] The invention relates to the technical field of aquatic organisms, in particular to a kit for identifying the degree of fatty liver of yellow catfish and an identification method thereof. Background technique [0002] Yellow catfish is one of the important aquaculture species in China. With the continuous promotion of new breeding technologies and the increasing variety of breeding methods, the output of yellow catfish in China has increased significantly. According to the statistics of the "China Fishery Yearbook", it has reached 480,000 tons in 2017, and it has been around 20% for several consecutive years. growing. Among them, the total production of yellow catfish aquaculture in Jiangsu, Zhejiang, Hubei, Jiangxi and Guangdong provinces accounts for more than 70% of the national total. The main breeds of yellow catfish include Valsalva yellow catfish, river yellow catfish, whole realgar catfish and hybrid yellow catfish. While achieving these gra...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6883A61K45/00A61P1/16
CPCC12Q1/6883A61K45/00A61P1/16C12Q2600/158C12Q2600/178
Inventor 强俊何杰徐跑陶易凡包景文朱昊俊曹哲明
Owner FRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI