Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method for increasing content of terpene substances to improve insect resistance of tomatoes

A technology of insect resistance and terpenes, applied in the field of agricultural biology, can solve the problem of loss of genetic resources of tomato

Pending Publication Date: 2020-10-23
FUJIAN AGRI & FORESTRY UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Monoterpenes and sesquiterpenes in terpenes play an important role in tomato's resistance to pests, but in the process of evolution and domestication, a large number of related genetic resources of tomato have been lost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for increasing content of terpene substances to improve insect resistance of tomatoes
  • Method for increasing content of terpene substances to improve insect resistance of tomatoes
  • Method for increasing content of terpene substances to improve insect resistance of tomatoes

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0030] Example 1: Construction of MYC1 overexpression system

[0031] RNA was extracted from tomato leaves according to the instructions of OMEGA's E.Z.N.A.® Plant RNA Kit. According to the instructions of TransScript All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (TRANS), it was reverse transcribed to obtain tomato leaf cDNA. Find the cDNA sequence of MYC1 on the tomato genome website (https: / / solgenomics.net / ), and design primers:

[0032] SEQ ID NO.2 MYC1 (+): 5'-CATTTGGAGAGGACACGCTCGAGATGACGGACTATAGATTATG GAGTA'3 and SEQ ID NO.3 MYC1 (-): 5'- TCGCCCTTGCTCACCATGAATTCTCGCGATTCAG CAATTTTTG -'3; tomato cDNA as template, primer SEQ ID NO.2 Using SEQ ID NO.3 as a primer, PCR amplifies the cDNA target fragment of MYC1, and the obtained target fragment has a size of 1893 bp, and its nucleotide sequence is shown in SEQ ID NO.1. Recover the target fragment, and connect the recovered fragment to the expression vector pHELLSGATE8 (universal vector) through In-fusion reacti...

example 2

[0033] Example 2: Establishment of plant expression system

[0034] (1) To prepare GV3101 Agrobacterium competent cells, the pHELLSGATE8-MYC1 The expression vector was transformed into GV3101 Agrobacterium competent cells, and the positive colonies were screened on LB plates containing a final concentration of 100 mg / L spectinomycin, 50 mg / L rifampicin and 15 mg / L gentamicin;

[0035] (2) After tomato seeds are sterilized, prepare for transformation after germination;

[0036] (3) Prepare Agrobacterium carrying the target gene, and shake the bacteria in large quantities at 28°C with liquid LB medium containing spectinomycin, 50 mg / L rifampicin and 15 mg / L gentamicin at a final concentration of 100 mg / L , shake to OD 600 =1.2~1.6. Centrifuge Agrobacterium at 2000 r / min for 10 min, collect the bacteria, and resuspend Agrobacterium in MS solution (OD 600 =0.8), to obtain the Agrobacterium suspension.

[0037] (4) Infect the explants cut from tomato cotyledons with the Agrob...

example 3

[0055] Example 3: Verification of plant phenotype after expressing MYC1

[0056] The functions of MYC1 and its homologous genes are very conserved in plants, and the homologous gene MYC2 is a key regulator of jasmonic acid signaling in Arabidopsis. We overexpressed MYC1 in tomato and found that MYC1 can significantly increase the content of terpenes in tomato, thereby improving the resistance of plants to biotic stress.

[0057] (1) After obtaining MYC1 overexpressing plants, use real-time quantitative PCR to screen tomato plants stably overexpressing MYC1 ( figure 1 A), after four weeks of plant growth, taking pictures with a camera showed that MYC1 overexpression (OE-MYC1-4) had no significant effect on plant growth and development ( figure 1 B).

[0058] (2) Take the leaves from the same part of the four-week-old plant, extract the RNA of the leaves, and conduct quantitative analysis on the TPSs gene responsible for the synthesis of terpenes in tomato. The results show ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for promoting terpene substance synthesis to improve the insect resistance of plants, and belongs to the technical field of agricultural biology. The tomato transcription factor MYC1 is subjected to constitutive overexpression, terpene substance synthesis is promoted, the insect resistance of plants is improved, and therefore high insect resistance is obtained underthe condition that few pesticides are applied to the plants. The MYC1 is constitutively expressed by utilizing a 35S promoter, so that the synthesis of terpene substance in a plant body is remarkablyimproved, and the insect resistance and related biological stress of the plant are improved. The constitutive expression of the MYC1 has no significant influence on the growth and development of plants. The method has important significance in increasing the content of terpene substances in plants, improving the insect resistance of the plants and other related biological stresses, has no obviousinfluence on the growth and development of the plants, and has great potential in the biotechnological improvement of various crops in the future, especially in the aspect of fixed-point improved breeding.

Description

technical field [0001] The invention belongs to the field of agricultural biotechnology, and in particular relates to a method for increasing the content of terpenes in plants. Background technique [0002] Tomato is an important horticultural plant worldwide and plays an important role in people's daily life. Tomatoes originated in the Andes Mountains. After a long period of evolution and human domestication, wild tomatoes have gradually become cultivated tomatoes in the market. In the process of human domestication, traits such as large yield, beautiful appearance and good flavor have been valued by humans, so they have been greatly preserved. However, the excellent stress resistance traits of some wild tomatoes have been lost in large quantities, so that the current cultivation Tomatoes performed poorly to biotic and abiotic stresses. Insect pests have serious harm to the growth and development of tomato. First, the pest itself causes mechanical damage and nutrient loss...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/82C12N15/84C12N1/21A01H5/00A01H6/82
CPCC07K14/415C12N15/8243C12N15/8279C12N15/8286
Inventor 吴双华兵常江许智晶
Owner FUJIAN AGRI & FORESTRY UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More