Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Miniaturized antibodies of antiglucocorticoids induced tumor necrosis factor receptor (GITR), and polymers and application thereof

A technology of tumor necrosis factor and corticosteroids, applied in the direction of anti-tumor drugs, antibody mimics/stents, applications, etc., can solve the problems of limited application range, complicated preparation process, poor tissue permeability, etc., and achieve anti-immune diseases/disorders Proliferative diseases/disorders, simple screening process, good tissue penetration effect

Inactive Publication Date: 2019-10-22
INNOVENT BIOLOGICS (SUZHOU) CO LTD
View PDF29 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] However, the above-mentioned anti-GITR antibodies with standard structures have some inherent defects of antibodies with standard structures: high production cost, long preparation period, complicated preparation process, large volume (poor tissue permeability), poor stability, and large differences between different batches, etc. , which greatly limits its scope of application
However, the antigen-binding surfaces of traditional antibody Fab fragments and single-chain antibody scFv often form a concave topology, and usually only recognize sites on the surface of the antigen.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Miniaturized antibodies of antiglucocorticoids induced tumor necrosis factor receptor (GITR), and polymers and application thereof
  • Miniaturized antibodies of antiglucocorticoids induced tumor necrosis factor receptor (GITR), and polymers and application thereof
  • Miniaturized antibodies of antiglucocorticoids induced tumor necrosis factor receptor (GITR), and polymers and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0287] In another aspect, the present invention provides a method comprising preparing the antibody of the present invention or its antigen-binding fragment, the fusion protein of the present invention or the immunoconjugate of the present invention (referred to as the preparation method of the present invention or the method of the present invention), Including: culturing the host cell of the present invention under conditions suitable for expressing the antibody or antigen-binding fragment thereof, fusion protein or immunoconjugate of the present invention.

[0288] In some embodiments, the methods of the present invention also include the use of any expression means that facilitate the expression and purification of the antibodies or antigen-binding fragments thereof, fusion proteins or immunoconjugates of the present invention, such as the use of secretion signal sequences, expression enhancing elements , high-efficiency promoters, and any other expression and regulatory el...

Embodiment 1

[0316] Example 1. Screening of anti-GITR Nanobodies

[0317] 1. Camel immunity

[0318] 1 mg of antigen GITR-His (Acro biosystems) was mixed with Freund's adjuvant (Sigma) in equal volume and divided into two tubes to immunize two Xinjiang Bactrian camels. In this way, immunization is performed once a week, and a total of 7 times are immunized to stimulate B lymphocytes to express antigen-specific nanobodies. After seven times of immunization, the serum titer of GITR-His Nanobody produced in Bactrian camels in Xinjiang can reach more than 1:1000, thus confirming that the desired Nanobody is produced in camels.

[0319] 2. Construction of phage display nanobody library

[0320] (1) After 7 times of immunization, extract 100ml camel blood, separate peripheral blood lymphocytes, and extract total RNA;

[0321] (2) Utilize RT-PCR to reverse transcribe the total RNA obtained in step (1) into cDNA, then utilize nested PCR (twice PCR) to amplify to obtain VHH, and its amplificatio...

Embodiment 2

[0342] Example 2. Construction, expression and purification of heavy chain antibodies

[0343] 1. Construction of heavy chain antibody (hcIgG):

[0344] (1) PCR amplification of cDNA of Nanobodies Nb-02, Nb-03, Nb-04, Nb-07, Nb-09, Nb-10, Nb-16, Nb-20.

[0345] (2) The PCR fragments obtained from gel recovery were constructed into the HEK293 expression vector pTT5 (Biotechnology Research Institute; Montreal, Canada) by homologous recombination (Vazyme, C112-01 / 02), which contained the following DNA sequences: IgG1Fc fragment:

[0346] GACAAAACCCACACCTGTCCCCCTTGTCCTGCTCCCGAGCTCCTGGGAGGACCTTCCGTGTTCCTCTTCCCTCCCAAACCCAAGGACACCCTGATGATTAGCAGGACACCCGAGGTGACCTGTGTGGTGGTGGATGTGAGCCATGAGGACCCCGAGGTGAAGTTTAACTGGTACGTGGACGGCGTCGAGGTGCACAACGCTAAGACCAAACCCAGGGAGGAGCAGTACAACTCCACATACCGGGTCGTGAGCGTGCTGACCGTCCTGCACCAGGATTGGCTGAATGGCAAGGAGTACAAGTGCAAGGTGAGCAACAAGGCCCTGCCCGCCCCCATCGAGAAGACCATCAGCAAGGCCAAAGGACAGCCTCGGGAGCCCCAGGTTTATACTCTCCCCCCCAGCCGGGACGAACTGACCAAGAATCAGGTGTCCCTCACCTGCCTCGTGAA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
affinityaaaaaaaaaa
Login to View More

Abstract

The invention provides antibodies specifically binding to a glucocorticoid induced tumor necrosis factor receptor (GITR), antibody fragments and polymers thereof, and conjugates and fusion substancescontaining the antibodies or the antibody fragments. The invention also provides nucleic acids encoding the antibodies, the antibody fragments, the polymers, the conjugates and the fusion substances;the invention also provides a carrier and a host cell expressing the nucleic acids. In addition, the invention further provides a composition including the antibodies and the antibody fragments, the polymers, conjugates or fusion substances, and a use thereof in treatment and diagnosis.

Description

technical field [0001] The present invention relates to the field of antibodies. In particular, the present invention relates to antibodies (including miniaturized antibodies), antibody fragments and polymers thereof that specifically bind to glucocorticoid-induced tumor necrosis factor receptor (GITR), as well as conjugates and fusions containing the antibodies or antibody fragments . The invention also relates to nucleic acids encoding these antibodies, antibody fragments, polymers, conjugates and fusions; vectors and host cells expressing the nucleic acids. Furthermore, the invention also relates to products comprising these antibodies and antibody fragments, polymers, immunoconjugates or fusions thereof, and their use in therapy and diagnosis. Background technique [0002] Glucocorticoid induced tumor necrosis factor receptor (GITR, also known as TNFRSF18, activation-inducible tumor necrosis factor receptor (TNFR) family member (AITR), CD357 and GITR-D), is a tumor Th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K16/28C07K19/00C12N15/13C12N15/62C12N15/85G01N33/68A61K39/395A61P35/00
CPCC07K16/2878G01N33/6872A61P35/00C07K2317/56C07K2317/24C07K2319/00C07K2317/622C07K2317/569C07K2317/31C07K2317/92A61K2039/505C12N15/62G01N33/6863G01N2333/715C07K2317/22C07K2317/94C07K2317/732C07K2317/35C07K2317/75C07K16/2818A61K2039/507A61K2039/54A61K2039/545C07K19/00C12N15/85G01N33/68
Inventor 缪小牛匡智慧黄威峰刘军建
Owner INNOVENT BIOLOGICS (SUZHOU) CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com