IncRNA application, kit and medicine

A kit and drug technology, applied in the application of lncRNA and the field of kits and drugs, can solve the problems of limited effect of diagnosis, treatment and prognosis of non-small cell lung cancer

Active Publication Date: 2019-10-22
SHENZHEN UNIV
View PDF11 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] The purpose of the present invention is to provide a lncRNA application, kit and medicine, aiming to solve t

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • IncRNA application, kit and medicine
  • IncRNA application, kit and medicine
  • IncRNA application, kit and medicine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Example 1 Selection of BRCAT54 and analysis of its expression difference

[0057] 1. Selection and grouping of research objects

[0058] Adult (≥18 years old) NSCLC cases and age-matched healthy controls were collected from the First Affiliated Hospital of Shenzhen University (Shenzhen Second People's Hospital). All research subjects signed the informed consent. The research protocol was approved by the Hospital Medical Ethics Committee.

[0059] The diagnosis of NSCLC was made according to the relevant diagnostic criteria of the "Chinese Standards for the Diagnosis and Treatment of Primary Lung Cancer (2015 Edition)", and the cases with clear pathological diagnosis were used as the research cases. Blood samples from NSCLC patients had not undergone surgery, radiotherapy or chemotherapy before blood collection. Through the analysis and sorting of the sample data, the standard samples were selected as the experimental samples for the lncRNA chip and subsequent series ...

Embodiment 2

[0092] Example 2 High expression of BRCAT54 inhibits NSCLC cell proliferation and migration, and promotes apoptosis

[0093] 1. Construction of BRCAT54 overexpression plasmid:

[0094] Primers were designed according to the sequence of BRCAT54 (NR_109862) in the NCBI database as follows:

[0095] upstream primer

[0096] SEQ ID No.2: 5'CCCAAGCTTAGTCGTGGTTTCCTGCGTTTGTAGA3';

[0097] downstream primer

[0098] SEQ ID No. 3: 5'CCGCTCGAGAGCATGATTCCCTGAGATAGGGTTT3'.

[0099] The human full-length BRCAT54 sequence (1395bp) was amplified with the above primers. And the target fragment was cloned into the expression vector pcDNA3.1 (Life, USA), the map is as follows Figure 5 As shown, it was finally named pcDNA3.1-BRCAT54, wherein the BRCAT54 insertion interval was between HindIII and XhoI.

[0100] First use the above primers to amplify the target gene by PCR, then digest the pcDNA3.1 plasmid with HindIII and XhoInei endonucleases, and configure the connection system according...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the technical field of molecular diagnosis, and particularly relates to IncRNA application, a kit and medicine. According to the application of IncRNA for preparing the kit for diagnosis and/or prognosis evaluation of NSCLC. The nucleotide sequence of the IncRNA is shown in SEQ ID No.1. The IncRNA is highly expressed in plasma before the NSCLC patient surgery, after the surgery, the expression level in the plasma is remarkably lowered, the expression levels in the NSCLC cancer tissue, the NSCLC patient plasma and the NSCLC cells are all remarkably higher than those ofpara-carcinoma tissue, healthy human plasma and normal bronchus epithelial cells. The study result suggests that the IncRNA has the remarkable capability for inhibiting the NSCLC cell tumor activity,and the IncRNA is newly found for tumor inhibition.

Description

technical field [0001] The invention belongs to the technical field of molecular diagnosis, and in particular relates to an application of lncRNA, a kit and a medicine. Background technique [0002] Lung cancer is the most common malignant tumor in the world today. The number of newly discovered lung cancer patients in the world exceeds 1.8 million every year, and the death caused by lung cancer accounts for about 30% of all cancer-related deaths. In the past three decades, the incidence and mortality of lung cancer in China have been rising rapidly. At present, the number of cases is nearly 1 million per year. Lung cancer has become an important risk factor that threatens the survival and health of Chinese residents. Among lung cancer patients, small cell lung cancer (SCLC) accounts for about 15%, and non-small cell lung cancer (NSCLC) accounts for about 85%. The latter is the main cause of lung cancer-related deaths. In the past 20 years, although the treatment methods of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/6886C12N15/113A61K31/7088A61P35/00
CPCC12Q1/6886C12N15/113A61K31/7088A61P35/00C12Q2600/118C12Q2600/136C12Q2600/158C12Q2600/178C12N2310/14Y02A50/30
Inventor 翟日洪钱有辉杨文瀚吴国栋
Owner SHENZHEN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap