IncRNA application, kit and medicine
A kit and drug technology, applied in the application of lncRNA and the field of kits and drugs, can solve the problems of limited effect of diagnosis, treatment and prognosis of non-small cell lung cancer
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0056] Example 1 Selection of BRCAT54 and analysis of its expression difference
[0057] 1. Selection and grouping of research objects
[0058] Adult (≥18 years old) NSCLC cases and age-matched healthy controls were collected from the First Affiliated Hospital of Shenzhen University (Shenzhen Second People's Hospital). All research subjects signed the informed consent. The research protocol was approved by the Hospital Medical Ethics Committee.
[0059] The diagnosis of NSCLC was made according to the relevant diagnostic criteria of the "Chinese Standards for the Diagnosis and Treatment of Primary Lung Cancer (2015 Edition)", and the cases with clear pathological diagnosis were used as the research cases. Blood samples from NSCLC patients had not undergone surgery, radiotherapy or chemotherapy before blood collection. Through the analysis and sorting of the sample data, the standard samples were selected as the experimental samples for the lncRNA chip and subsequent series ...
Embodiment 2
[0092] Example 2 High expression of BRCAT54 inhibits NSCLC cell proliferation and migration, and promotes apoptosis
[0093] 1. Construction of BRCAT54 overexpression plasmid:
[0094] Primers were designed according to the sequence of BRCAT54 (NR_109862) in the NCBI database as follows:
[0095] upstream primer
[0096] SEQ ID No.2: 5'CCCAAGCTTAGTCGTGGTTTCCTGCGTTTGTAGA3';
[0097] downstream primer
[0098] SEQ ID No. 3: 5'CCGCTCGAGAGCATGATTCCCTGAGATAGGGTTT3'.
[0099] The human full-length BRCAT54 sequence (1395bp) was amplified with the above primers. And the target fragment was cloned into the expression vector pcDNA3.1 (Life, USA), the map is as follows Figure 5 As shown, it was finally named pcDNA3.1-BRCAT54, wherein the BRCAT54 insertion interval was between HindIII and XhoI.
[0100] First use the above primers to amplify the target gene by PCR, then digest the pcDNA3.1 plasmid with HindIII and XhoInei endonucleases, and configure the connection system according...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap