Cleaved amplified polymorphic sequence (CAPS) molecular marker suitable for identification of red pulp honey pomelo, white pulp honey pomelo and yellow pulp honey pomelo and application of CAPS molecular marker
A technology of honey pomelo with red meat and honey with white meat, which is applied in the direction of recombinant DNA technology, biochemical equipment and methods, and microbial measurement/inspection. Breeding workload, effect of ensuring purity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1 CAPS marker establishment and screening of primer-specific primers
[0031] Using DNA-seq to detect the differential SNP sites in red meat-vs-white meat honey pomelo:
[0032] Leaf DNA of red-fleshed pomelo and white-flesh pomelo were extracted, and DNA sequencing was performed on the Illumina platform (sequencing depth: 30×). Use BWA software to compare the sequencing data of red-fleshed honey pomelo and white-fleshed honey pomelo to the pomelo reference genome, and SAMtools software for genotyping to determine the SNP sites of differences between red-fleshed honey pomelo and white-fleshed honey pomelo, such as SED ID No.1 and 2, for the development of red-fleshed pomelo and white-flesh pomelo differential markers. in,
[0033] SED ID No.1:
[0034] CGCACTAATCTTTTCTCCCAACTTTTAAATTGCCTCCTTGTTCATGCACATTATGGGTATCTTATGAATCTACCCAAAATGTTGCATGTGTAAAGGATTGATTTTTAATATCTCCAATCCCAGTTGGTTGAGTCAAAACTATCAGTGCTATGTCAAAATGCAATGGTCCTCCCATAAGCACCCTTTTCTTTTCTTCTCCCTATGAATGTT...
Embodiment 2
[0050] The kit for distinguishing honey pomelo with red flesh, honey pomelo with white flesh and honey pomelo with yellow flesh includes the above-mentioned pair of specific primers, the specific primer pair is composed of primer pair RW F / R and primer pair YW F / R, and the RW F / R, YW F / R are as follows:
[0051] Forward primer RW-F: 5'-CGCACTAATCTTTTTTCTCCAACT-3',
[0052] Reverse primer RW-R: 5'-AATACTACTCTCATTCTCCCAA-3'.
[0053] Forward primer YW-F: 5'-CTGCTTAGGGATTTGC-3',
[0054] Reverse primer YW-R: 5'-TGTTCTGGTGGACTGG-3'.
[0055] The above-mentioned kit differentiates the method for honey pomelo with red flesh, honey pomelo with white flesh and honey pomelo with yellow flesh: comprise the following steps:
[0056] 1) Using the improved CTAB method to extract the genomic DNA of honey pomelo with red meat, white meat and honey pomelo with yellow meat;
[0057] 2) Use the primer pair RW F / R in the above kit to amplify and analyze the genomic DNA of pomelo with re...
Embodiment 3
[0077] Utilize above-mentioned kit to detect 9 samples, such as Figure 3-4 The result shows: 3 parts of honey pomelo with white flesh, 3 parts of honey pomelo with yellow flesh, 3 parts of honey pomelo with red flesh.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap