Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Cleaved amplified polymorphic sequence (CAPS) molecular marker suitable for identification of red pulp honey pomelo, white pulp honey pomelo and yellow pulp honey pomelo and application of CAPS molecular marker

A technology of honey pomelo with red meat and honey with white meat, which is applied in the direction of recombinant DNA technology, biochemical equipment and methods, and microbial measurement/inspection. Breeding workload, effect of ensuring purity

Active Publication Date: 2019-11-19
HUAZHONG AGRICULTURAL UNIVERSITY
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The traditional identification method is easily disturbed by factors such as growth period and environmental conditions. In the cultivation of seedlings, the number of morphological markers is small and easily disturbed by environmental factors. It is difficult to distinguish different varieties in childhood

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cleaved amplified polymorphic sequence (CAPS) molecular marker suitable for identification of red pulp honey pomelo, white pulp honey pomelo and yellow pulp honey pomelo and application of CAPS molecular marker
  • Cleaved amplified polymorphic sequence (CAPS) molecular marker suitable for identification of red pulp honey pomelo, white pulp honey pomelo and yellow pulp honey pomelo and application of CAPS molecular marker
  • Cleaved amplified polymorphic sequence (CAPS) molecular marker suitable for identification of red pulp honey pomelo, white pulp honey pomelo and yellow pulp honey pomelo and application of CAPS molecular marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 CAPS marker establishment and screening of primer-specific primers

[0031] Using DNA-seq to detect the differential SNP sites in red meat-vs-white meat honey pomelo:

[0032] Leaf DNA of red-fleshed pomelo and white-flesh pomelo were extracted, and DNA sequencing was performed on the Illumina platform (sequencing depth: 30×). Use BWA software to compare the sequencing data of red-fleshed honey pomelo and white-fleshed honey pomelo to the pomelo reference genome, and SAMtools software for genotyping to determine the SNP sites of differences between red-fleshed honey pomelo and white-fleshed honey pomelo, such as SED ID No.1 and 2, for the development of red-fleshed pomelo and white-flesh pomelo differential markers. in,

[0033] SED ID No.1:

[0034] CGCACTAATCTTTTCTCCCAACTTTTAAATTGCCTCCTTGTTCATGCACATTATGGGTATCTTATGAATCTACCCAAAATGTTGCATGTGTAAAGGATTGATTTTTAATATCTCCAATCCCAGTTGGTTGAGTCAAAACTATCAGTGCTATGTCAAAATGCAATGGTCCTCCCATAAGCACCCTTTTCTTTTCTTCTCCCTATGAATGTT...

Embodiment 2

[0050] The kit for distinguishing honey pomelo with red flesh, honey pomelo with white flesh and honey pomelo with yellow flesh includes the above-mentioned pair of specific primers, the specific primer pair is composed of primer pair RW ​​F / R and primer pair YW F / R, and the RW F / R, YW F / R are as follows:

[0051] Forward primer RW-F: 5'-CGCACTAATCTTTTTTCTCCAACT-3',

[0052] Reverse primer RW-R: 5'-AATACTACTCTCATTCTCCCAA-3'.

[0053] Forward primer YW-F: 5'-CTGCTTAGGGATTTGC-3',

[0054] Reverse primer YW-R: 5'-TGTTCTGGTGGACTGG-3'.

[0055] The above-mentioned kit differentiates the method for honey pomelo with red flesh, honey pomelo with white flesh and honey pomelo with yellow flesh: comprise the following steps:

[0056] 1) Using the improved CTAB method to extract the genomic DNA of honey pomelo with red meat, white meat and honey pomelo with yellow meat;

[0057] 2) Use the primer pair RW ​​F / R in the above kit to amplify and analyze the genomic DNA of pomelo with re...

Embodiment 3

[0077] Utilize above-mentioned kit to detect 9 samples, such as Figure 3-4 The result shows: 3 parts of honey pomelo with white flesh, 3 parts of honey pomelo with yellow flesh, 3 parts of honey pomelo with red flesh.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of citrus molecular breeding, and discloses a cleaved amplified polymorphic sequence (CAPS) molecular marker suitable for identification of a red pulp honey pomelo, a white pulp honey pomelo and a yellow pulp honey pomelo and application of the CAPS molecular marker. The CAPS molecular marker and application of the CAPS molecular marker are suitable foridentification of Guanxi honey pomelo different bud varieties, and the CAPS molecular marker of the red pulp honey pomelo, the white pulp honey pomelo and the yellow pulp honey pomelo and applicationof the CAPS molecular marker are included. According to the CAPS molecular marker and application of the CAPS molecular marker, a set of specific PCR primers are designed by using DNA sequence information of a known site, then the primers are used for amplifying a certain DNA fragment at the site, an obtained amplified product is then incised with a specific restriction incision enzyme, separation of enzyme cleavage fragments is conducted by gel electrophoresis, and different materials are identified by analyzing electrophoresis results. The CAPS molecular marker is developed and can be usedfor identification of Guanxi honey pomelo nursery stock early varieties, and results are accurate and reliable.

Description

technical field [0001] The invention relates to the technical field of citrus molecular breeding, in particular to a CAPS molecular marker suitable for identifying red-fleshed pomelo, white-flesh pomelo and yellow-flesh pomelo and its application. Background technique [0002] Guanxi honey pomelo is a citrus fruit of Rutaceae, native to Pinghe County, Fujian Province, and is a famous product of cultivated pomelo. Guanxi honey pomelo is large seedless with high quality, strong adaptability, high yield and good commerciality. Guanxi honey pomelo is characterized by thin and juicy skin, sweet and mellow, moderate sweet and sour. Red-fleshed pomelo and yellow-fleshed pomelo are derived from the buds of Guanxi pomelo. The flesh of the ripe fruit is red and orange-yellow. The change in the color of the pulp makes red-flesh pomelo and yellow-flesh pomelo have good health benefits. Can attract consumers and bring higher economic value. [0003] The price of seedlings of red-flesh...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12Q1/6895C12Q1/6858
CPCC12Q1/6895C12Q1/6858C12Q2600/156C12Q2531/113C12Q2521/301C12Q2565/125
Inventor 徐强罗鑫王霞余惠文苗萌萌刘晓通
Owner HUAZHONG AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com