Two-chamber gene bjmc1 and three-chamber gene bjmc1 related to the multi-chamber trait of Brassica napus and its application
A mustard-type rapeseed, gene technology, applied in application, genetic engineering, plant genetic improvement and other directions, can solve problems such as unfavorable new high-yield variety breeding, and achieve the goal of reducing breeding workload, shortening breeding years, and speeding up the process of breeding. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Sequences of two-compartment gene BjMc1 and three-compartment gene Bjmc1 in Brassica napus:
[0037] 1. Experimental materials
[0038] The materials used in this experiment were the two-compartment variety J248 of the mustard type rape and the three-compartment variety J163-4 of the mustard type rape as the parents to construct the BC 4 f 1 The group carried out the initial mapping of the two-compartment gene BjMc1 in Brassica napus (Xu et al.2014). On this basis, continue to use the two-chambered plants in the near-isogenic line as the donor parent, and the three-chambered plants as the recurrent parents, and obtain the near-isogenic line mapping population through brother-sister crossing.
[0039] The near-isogenic mapping population is defined by the BC 5 f 1 Near isogenic lines (3700 individual plants) and BC 6 f 1 Near isogenic lines (5600 individual plants) constituted. For the DNA extraction method of a single plant of a near-isogenic line, see: Stewart a...
Embodiment 2
[0067] Genetic transformation of three-compartment gene Bjmc1 and two-compartment gene BjMc1 in Arabidopsis:
[0068] 1. Genetic transformation of the three-compartment gene Bjmc1 in Arabidopsis
[0069] The backbone of the three-compartment gene Bjmc1 overexpression vector p35S::Bjmc1 selects the transformed pMDC83 carrier (the transformed pMDC83 carrier is a pMDC83 carrier connected after Sca I digestion), and the resistance of the carrier in plants is The resistance in bacteria is kanamycin. from BC 5 f 1 A 3036bp fragment of the target gene Bjmc1 was isolated from the genomic DNA of the three-compartment plants of the population, including a 687bp fragment downstream of the stop codon. The amplification primers are:
[0070] HY-4L: ATGGAGATGAGACTTTTGAAAACAC
[0071] HY-4R: CTGCAAGACGGACTGAGTTAACA.
[0072] The cloned fragment was inserted into the Xba I-Sac I site ( Figure 5 ). The gene fragment cloning operation was consistent with the vector construction in Exam...
Embodiment 3
[0080] Acquisition of a molecular marker M1-1 related to multilocular traits in Brassica napus:
[0081] According to the obtained BjMc1 gene, Bjmc1 gene, copia-LTR reverse transcriptase transposon sequence and its insertion site in the Bjmc1 gene, the present invention develops co-segregation molecular marker M1-1. It is expected that M1-1 (including three primers M1-1L, M1-1F and M1-1R) will amplify the genomic DNA of Brassica napus J248 and Brassica napus J163-4 under PCR conditions, and amplify in J248 A fragment of about 1200bp was amplified, while a fragment of about 250bp was amplified in J163-4.
[0082] The present invention utilizes the primers designed in the above steps to carry out PCR amplification. The PCR reaction system is as follows: 1×PCRbuffer, 1.35mM MgCl 2 , 0.08mM dNTPs, 1.0U DNA polymerase (both purchased from MBI Fermentas, Lithuanin Company), 100ng DNA, two forward primers M1-1L and M1-1F each plus 0.5uM, reverse primer plus 1uM, ddH 2 O supplement...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



