Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Two-chamber gene bjmc1 and three-chamber gene bjmc1 related to the multi-chamber trait of Brassica napus and its application

A mustard-type rapeseed, gene technology, applied in application, genetic engineering, plant genetic improvement and other directions, can solve problems such as unfavorable new high-yield variety breeding, and achieve the goal of reducing breeding workload, shortening breeding years, and speeding up the process of breeding. Effect

Active Publication Date: 2019-08-16
HUAZHONG AGRI UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The multilocular traits of Brassica napus and Brassica napus have chimerism, which is not conducive to the breeding of new high-yielding varieties

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Two-chamber gene bjmc1 and three-chamber gene bjmc1 related to the multi-chamber trait of Brassica napus and its application
  • Two-chamber gene bjmc1 and three-chamber gene bjmc1 related to the multi-chamber trait of Brassica napus and its application
  • Two-chamber gene bjmc1 and three-chamber gene bjmc1 related to the multi-chamber trait of Brassica napus and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Sequences of two-compartment gene BjMc1 and three-compartment gene Bjmc1 in Brassica napus:

[0037] 1. Experimental materials

[0038] The materials used in this experiment were the two-compartment variety J248 of the mustard type rape and the three-compartment variety J163-4 of the mustard type rape as the parents to construct the BC 4 f 1 The group carried out the initial mapping of the two-compartment gene BjMc1 in Brassica napus (Xu et al.2014). On this basis, continue to use the two-chambered plants in the near-isogenic line as the donor parent, and the three-chambered plants as the recurrent parents, and obtain the near-isogenic line mapping population through brother-sister crossing.

[0039] The near-isogenic mapping population is defined by the BC 5 f 1 Near isogenic lines (3700 individual plants) and BC 6 f 1 Near isogenic lines (5600 individual plants) constituted. For the DNA extraction method of a single plant of a near-isogenic line, see: Stewart a...

Embodiment 2

[0067] Genetic transformation of three-compartment gene Bjmc1 and two-compartment gene BjMc1 in Arabidopsis:

[0068] 1. Genetic transformation of the three-compartment gene Bjmc1 in Arabidopsis

[0069] The backbone of the three-compartment gene Bjmc1 overexpression vector p35S::Bjmc1 selects the transformed pMDC83 carrier (the transformed pMDC83 carrier is a pMDC83 carrier connected after Sca I digestion), and the resistance of the carrier in plants is The resistance in bacteria is kanamycin. from BC 5 f 1 A 3036bp fragment of the target gene Bjmc1 was isolated from the genomic DNA of the three-compartment plants of the population, including a 687bp fragment downstream of the stop codon. The amplification primers are:

[0070] HY-4L: ATGGAGATGAGACTTTTGAAAACAC

[0071] HY-4R: CTGCAAGACGGACTGAGTTAACA.

[0072] The cloned fragment was inserted into the Xba I-Sac I site ( Figure 5 ). The gene fragment cloning operation was consistent with the vector construction in Exam...

Embodiment 3

[0080] Acquisition of a molecular marker M1-1 related to multilocular traits in Brassica napus:

[0081] According to the obtained BjMc1 gene, Bjmc1 gene, copia-LTR reverse transcriptase transposon sequence and its insertion site in the Bjmc1 gene, the present invention develops co-segregation molecular marker M1-1. It is expected that M1-1 (including three primers M1-1L, M1-1F and M1-1R) will amplify the genomic DNA of Brassica napus J248 and Brassica napus J163-4 under PCR conditions, and amplify in J248 A fragment of about 1200bp was amplified, while a fragment of about 250bp was amplified in J163-4.

[0082] The present invention utilizes the primers designed in the above steps to carry out PCR amplification. The PCR reaction system is as follows: 1×PCRbuffer, 1.35mM MgCl 2 , 0.08mM dNTPs, 1.0U DNA polymerase (both purchased from MBI Fermentas, Lithuanin Company), 100ng DNA, two forward primers M1-1L and M1-1F each plus 0.5uM, reverse primer plus 1uM, ddH 2 O supplement...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of rape breeding and particularly relates to a two-room gene BjMc1 and a three-room gene Bjmc1 which are relates to multiicapsular traits of mustard-type rapes and an application of the two-room gene BjMc1 and the three-room gene Bjmc1. The two-room gene BjMc1 and the three-room gene Bjmc1 of the mustard-type rapes are firstly obtained from clone of the mustard-type rapes, and the two-room gene of the rapes can be subjected to genetic engineering to obtain the three-room rapes high in yield by the aid of the technology. The two-room gene BjMc1 and the three-room gene Bjmc1 can be respectively and specifically amplified by provided molecular markers of M1-1, breeding work can be reduced by applying the molecular markers on assistant selection of the mustard-type rapes with the three-room traits to overcome the shortcoming of performing selection by relying phenotype in conventional breeding, breeding periods are shortened, and processing of the mustard-type rape breeding is fastened.

Description

[0001] Technical field: [0002] The invention belongs to the technical field of rapeseed breeding. It specifically relates to the two-compartment gene BjMc1 and the three-compartment gene Bjmc1 related to the multi-compartment trait of Brassica napus and their applications. The recessive gene Bjmc1 involved in the present invention is a functional defect mutant of the dominant gene BjMc1. The cloning, verification and application of the two-compartment gene BjMc1 in Brassica napus can speed up the application of the three-compartment trait in the breeding of new varieties of rapeseed and other crops, thereby speeding up the breeding of new high-yield varieties of rapeseed. [0003] technical background: [0004] Rapeseed is one of the four major oil crops in the world. It has been planted in my country for more than 2,000 years and occupies an important position in edible oil. Since the 1990s, my country has become the country with the largest planting area of ​​rapeseed in t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/11C12Q1/6895
CPCC07K14/415C12Q1/6895C12Q2600/13
Inventor 沈金雄徐平曹诗琴傅廷栋涂金星马朝芝易斌文静李兴华
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com