Long non-coding RNA and application thereof

A long-chain non-coding, useful technology, applied in the field of biomedicine, can solve problems such as unclearness and changes in downstream cell functions

Pending Publication Date: 2019-12-03
SHENZHEN INST OF ADVANCED TECH CHINESE ACAD OF SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are relatively few studies on LncRNA regulating miR-181a. It has been reported that miR-181a can regulate the expression of KLF6 at the post-transcriptional level by binding to the 3'-UTR of KLF6. It has an important regulatory function in different tumors. However, it is still unclear whether there is LncRNA that specifically regulates miR-181a and then affects the expression of KLF6, which ultimately leads to changes in downstream cell functions.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Long non-coding RNA and application thereof
  • Long non-coding RNA and application thereof
  • Long non-coding RNA and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 Identification of long non-coding RNA and analysis of luciferase activity

[0038] Using the UCSC online genome database analysis, it was found that there were a series of potential long-chain non-coding RNAs downstream of KLF6, as shown in Figure 1 (A), so there may be long-chain non-coding RNAs for feedback regulation of KLF6;

[0039] Based on previous reports, miR-181a has a targeted regulatory effect on KLF6; therefore, the analysis of long-chain non-coding RNA transcripts found that one of the long-chain non-coding RNA transcripts, Lnc00705, has four binding sites for miR-181a point, see Figure 1(B);

[0040] The nucleotide sequence of Lnc00705d is shown in SEQ ID No.1, and the nucleotide sequence of its transcript is shown in SEQ ID No.2.

[0041] SEQ ID No.1 is as follows:

[0042] GCGGAATATACGACTCACTATAGGGAGACCCAAGCTGGCTAGCGTTTAAACTTAAGCTTGCCACCTTTGATGTCTAGAATCAGGGGATCCGAATGTTATTTAATGGTGCCAATGATGTTGGAGGATACCTGTGGGAACCTGGATTAGAAGCATGTGCTGCTCTCAGACCTG...

Embodiment 2

[0048] Example 2 Long non-coding RNA targets miR-181a to inhibit the expression of KLF6

[0049] The mucosal cell line GES-1 was used for routine culture. When the cell density reached 70%, Lnc00705siRNA was transfected with Lipofectamine 2000 (Invitrogen), and the medium was changed after 6 hours of transfection, and the culture was continued for 48 hours for the experiment;

[0050] The nucleotide sequence of Lnc00705siRNA is shown in SEQ ID No.3:

[0051] CUGACCAGCAUAGAUGUUA.

[0052] The detection of mRNA and protein expression levels was carried out by qRT-PCR and western blot respectively, and the results were as follows Figure 3(A)-Figure 3(C) shown;

[0053] Depend on Figure 3(A)-Figure 3(C) It can be seen that after inhibiting the expression of Lnc00705, miR-181a is upregulated, while the expression of KLF6 is down-regulated at both mRNA and protein levels.

Embodiment 3

[0054] Example 3 Effect of long non-coding RNA on proliferation and apoptosis of GES-1 cells

[0055] The effect of MTT method and flow cytometry on the proliferation and apoptosis of GES-1 cells after inhibiting Lnc00705, the results are as follows Figure 4(A)-Figure 4(C) shown;

[0056] Depend on Figure 4(A)-Figure 4(C) It can be seen that, compared with the control, inhibiting Lnc00705 promoted the proliferation of GES-1 cells and inhibited cell apoptosis.

[0057] In summary, the present invention provides a long-chain non-coding RNA and its application. The long-chain non-coding RNA is LncRNA00705, which is located downstream of the KLF6 gene. LncRNA00705 acts as a regulatory factor for diseases caused by miR-181a and KLF6 abnormalities, The medicine for preparing related diseases has broad application prospect and market value.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides long non-coding RNA and an application thereof. The long non-coding RNA is LncRNA00705, and is located at the downstream of KLF6 gene. Through design of precise experiment, andthrough step-by-step screening, the application of the gene is found and determined. Regulatory factors of diseases caused by abnormal miR-181a and KLF6 effects of LncRNA00705 are used for preparing medicines for relevant diseases, and the long non-coding RNA has wide application prospects and market value.

Description

technical field [0001] The invention relates to the field of biomedicine, in particular to a long-chain non-coding RNA and its application. Background technique [0002] Long non-coding RNA (Long non-coding RNA, LncRNA) is a non-coding RNA longer than 200 nucleotides. LncRNAs usually have an mRNA-like structure, spliced, polyA tail and promoter structure, dynamic expression and different splicing modes during differentiation. Most lncRNAs have obvious spatiotemporal expression specificity during tissue differentiation and development, and have characteristic expression patterns in tumors and other diseases. Studies have shown that lncRNA plays an important role in many life activities such as dose compensation effect, epigenetic regulation, cell cycle regulation and cell differentiation regulation, and has become a hot spot in genetics research. At present, there have been a large number of reports on the mechanism of LncRNAs, including: 1) binding to a specific protein an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113A61K31/7105A61K31/7088A61P13/08A61P25/00A61P35/00A61P29/00
CPCC12N15/1135A61P13/08A61P25/00A61P35/00A61P29/00C12N2310/10C12N2310/14Y02A50/30
Inventor钱政江杨海洋李燕娇韦命余李伟丽李翔
OwnerSHENZHEN INST OF ADVANCED TECH CHINESE ACAD OF SCI