Monoclonal antibody against human neurofilament light polypeptide (NEFL) and application thereof
A monoclonal antibody, microbial strain technology, applied in the biological field, can solve the problem of no detection reagent registration and other problems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Embodiment 1: the preparation of anti-NEFL monoclonal antibody
[0023] 1. Production of NEFL recombinant protein
[0024] The NEFL gene NM_006158 was selected from Genebank. The gene encodes 543 amino acids (aa) in the full length of NEFL, located at 355-1986nt. The immunogen of the antibody of the present invention is NEFL1-360aa, located at 355-1432nt. Known technical methods clone the gene into pET23a expression plasmid with his tag at the C-terminal, express in BL21 Escherichia coli, purify with nickel column, and identify the purity by SDS-PAGE electrophoresis. After electrophoresis, the target protein band with a molecular weight of about 43kDa was observed on the gel, and the purity was above 90%, which met the purity requirement for the preparation of monoclonal antibody.
[0025] 2. Animal immunity
[0026] The above-mentioned purified NEFL recombinant protein was emulsified with complete Freund's adjuvant, and immunized 6-8 week-old BALB / c mice by subcutane...
Embodiment 2
[0029] Embodiment 2: the identification of anti-NEFL monoclonal antibody
[0030] Through Example 1, 4 monoclonal antibody strains were obtained, namely OTI3G2, OTI11F6, OTI2F5, and OTI11F8, and were identified as follows.
[0031] 1. Specific identification of monoclonal antibodies
[0032] It was detected by indirect ELISA method. Coat the microtiter plate with NEFL, NEFM, NEFH, GFAP, UCH-L1, BSA, PET23a empty plasmid-transferred E. coli lysate, PCMV6 plasmid-transferred 293 cell lysate, etc., at a concentration of 5 μg / ml, overnight at 4°C. Block the plate with PBST containing 1% BSA, add 10 4 Two-fold diluted purified antibody, reacted at 37°C for 50min, washed the plate three times with PBST, and added HRP-labeled goat anti-mouse secondary antibody.
[0033]The results showed that the lysates of NEFM, NEFH, GFAP, UCH-L1, BSA, and PET23a empty plasmids transferred to E. coli, and the lysates of PCMV6 plasmids transferred to 293 cells were all negative for the 4 strains ...
Embodiment 3
[0043] Embodiment 3: gene sequencing and analysis of the variable region of monoclonal antibody
[0044] Procured from Takara Bio USA RACE 5' / 3' kit, using 5' RACE (Rapid Amplification of cDNA Ends, rapid amplification of cDNA ends) technology to clone the variable region sequence of functional antibody from the hybridoma cell line OTI11F6 secreting anti-NEFL monoclonal antibody . The specific experimental process is as follows, see Takara Bio USA company RACE 5’ / 3’Kit User Manual.
[0045] According to the IgG1 subtype of the antibody OTI11F6, specific gene primers pRace-H-GSP and pRace-K-GSP were designed for the 3' ends of its Ig and Kapa constant regions, and the primer sequences were as follows:
[0046] pRace-H-GSP:CATCDGTCTATCCACTGGCCCCTG
[0047] pRace-K-GSP:CTTCCCACCATCCAGTGAGCAGTT
[0048] The DNA fragments of the light and heavy chains of the antibody were amplified by RACE PCR, and the results are shown in figure 1 ,from figure 1 It can be seen that the...
PUM
Property | Measurement | Unit |
---|---|---|
Affinity constant | aaaaa | aaaaa |
Linear | aaaaa | aaaaa |
Molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap